Browse Record

Family Hygrophoraceae
Accession Number F035878
Genus Hygrocybe
Species conica
Species Author (Schaeff.)  P.  Kumm.
Country Canada
Province_State British  Columbia
Location Capilano  Regional  Park,  North  Vancouver  British  Columbia
Latitude 49.356864
Longitude -123.111208
Altitude 107  m
Date 28/10/2023    (DD/MM/YYYY)
GeneBank Accession Number PP550902
Morphological Description Red  and  orange  gradient  bright  cap.  Long  thin  yellow  stalk  that  easily  becomes  strips.  Turning  black  as  it  dries  and  black  at  the  bottom  of  the  stalk.
Collector Katherine  Liu
Number KL20231028-02
Other Collectors Sung  Ik  Lee,  Bo  Yang,  Justin  Chan
Determined by Katherine  Liu
Host Substratum on  the  wet  ground  near  foliage  and  moss
Notes Near  Conifer  trees  and  was  standing  alone  on  a  hill
Habitat On  wet  soil  substrate  with  fallen  and  decaying  coniferous  leaves  and  wood  around  it;
DNA  sequence  in  GeneBank CATTACTGAAGTGATTTGGGGATGTTGCTGGCCCCTCCTCAGGGGGCAATGTGCACTCCCTGAACAATTCACAATCTCCATCACACCCTTGTGCACATTTTGTAGGCACCCTCTCACCTCTCTTGGTTGGGACATGGTGTCCTATGTATTCTATCACCTCACACTTTGCCTCTTGAACGCACCTTATGGATTATTTGTAAAAGTAATCACAGAAACAACTTTCAACAATGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACCTTGCGCCTCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTGAATCCTCAAAAAGAGAAAACTTAATGGTTTCTCTCTTTTGGAATTGGGGYGTGCTGGCCTTTTCTTGGAAAGCTCAGCTCCCCTGAAATACATTAGCGATGTGACATCCTCATGCTCCACGCTTCTCTGGCATTGATAGTCTTTTCATGCTTTGAGCGTGTTCTGCAGCTGTGGAAAGTTTTGCTYGCTCACAACTGATGGGTTTCACCCATCCTCTGACC
Name  of  Sequencer Katherine  Liu
Specimen Images
Image of PA282236.jpeg
Cap  shape  when  mature 1 conical/bell  shape
phylum Basidiomycota
material  collected gilled  mushroom
morphology  summary Material  collected:  gilled  mushroom
Habit:  1  solitary  or  scattered
Color  of  top  surface:  4  yellow/gold
Secondary  color  top  surface:  7  red
Spore  print  color:  1  white
Hymenium  color  when  young:  3  pale  yellow  or  cream
Hymenium  color  when  mature:  3  pale  yellow  or  cream
Spore  length:  7.5
Spore  width:  7.5
Smell:  2  mild/none
Taste:  3  mild/none
Flesh  hardness:  2  firm,  fleshy
Cap  shape  when  mature:  1 conical/bell  shape
Cap  shape  in  center:  2  even  or  flat
Cap  shape  from  above:  1  circular-even  if  wavy
Cap  color  with  age:  4  yellow/gold
Cap  stain  color:  17  none  -  no  stains  or  not  applicable
Cap  width:  19
Cap  surface  texture:  2  smooth
Cap  stickiness:  1  dry
Cap  has  concentric  zones  of  color:  No
Cap  stalk  easily  part:  Yes
Cap  hygrophanous:  No
Cap  flesh  color:  4  yellow/gold
Flesh  toughness:  2  easy  to  break  or  tear,  but  not  fragile
Flesh  fracture:  4  brittle  or  crumbly
Cap  margin  surface:  1  pleated,  grooved,  streaked,  or  ribbed(edge)
Cap  edge:  1  smooth
Stipe  shape:  3  equal
Stipe  core:  2  hollow
Stipe  position:  1  central
Stipe  flesh  hardness:  2  firm,  fleshy
Stipe  flesh  toughness:  2  easy  to  break  or  tear,  but  not  fragile
Stipe  flesh  fracture:  3  fibrous-tears  easier  in  one  direction
Stipe  flesh  color:  4  yellow/gold
Stipe  flesh  stain  color:  17  none  -  no  stains  or  not  applicable
Stipe  primary  color:  4  yellow/gold
Stipe  secondary  color:  15  black  or  dark  gray
Stipe  stain  color:  17  none  -  no  stains  or  not  applicable
Stipe  surface  texture:  8  fibrilose
Stipe  width:  7
Stipe  length:  40
Gill  attachment:  2  adnexed
Gill  collarium:  No
Gill  sawtooth  edge:  No
Hymenium  stain  color:  1  white
Gills  break  from  cap:  No
Gills  deliquescent:  No
Gills  mottled  face:  No
Gills  secede  from  stalk:  No
Gills  waxy  feel:  Yes
Gills  anastomosing:  No
Gills  forked:  No
Ring  type:  5  none
Partial  veil  type:  5  none
Ring  location  on  stalk:  5  none
Ring  number:  3  none
Ring  color:  17  none  -  no  stains  or  not  applicable
Volva  type:  6  none
Volva  color:  17  none  -  no  stains  or  not  applicable
Latex  color:  17  none  -  no  stains  or  not  applicable
Latex  stain  color:  17  none  -  no  stains  or  not  applicable
Reaction  ammonia  color:  17  none  -  no  stains  or  not  applicable
Reaction  Fe.  Sul.  color:  17  none  -  no  stains  or  not  applicable
Reaction  Melzer's  color:  17  none  -  no  stains  or  not  applicable
Reaction  potassium:  17  none  -  no  stains  or  not  applicable
Spore  shape:  3  elliptical
Spore  ornamentation:  none
cystidia:  pleurocystidia
clamp  connections:  n/a
cap  cuticle  type:  none
trama  type:  none
Time  Modified 20:50:49
Date  Created 06/11/2023
mycology project ID 964