Browse Record

Family Fomitopsidaceae
Accession Number F035869
Genus Cystidiopostia
Species hibernica
Species Author (Berk.  &  Broome)  B.K.  Cui,  L.L.  Shen  &  Y.C.  Dai
Country Canada
Province_State BC
Location Capilano  River  Regional  Park,  North  Vancouver.  Found  on  the  the  west  side  of  the  river  approximately  20m  west  of  the  second  canyon  trail.
Latitude 49.3557
Longitude -123.11144
Altitude 90  m
Date 28/10/2023    (DD/MM/YYYY)
GeneBank Accession Number PP550893
Morphological Description A  white,  fleshy  polypore  growing  form  dead  hardwood  with  no  discernible  stipe.  Margins  remain  irregular  along  with  pilleus  structure.  Fungus  is  dry  with  no  discernible  odour  or  taste.
Collector Simon  Mattern
Number SM102923.2
Other Collectors   Freya  Zhu,  Isabella  Factor,  Lauren  Brown
Determined by Simon  Mattern
Host Substratum Fruiting  body  found  growing  of  moist  decaying  wood,  presumably  a  conifer  branch
Notes Fungi  is  white  in  colour  growing  in  bracket  with  no  obvious  shape.  Margins  are  globular  and  pores  are  large  and  present  on  underside  of  cap.  Producing  basidium  ranging  from  5um  to  12.5um  in  size.  cap  is  dry,  smooth  and  corky  with  no  distinct  smell  and  a  delayed  bitter  flavour.
Habitat Found  on  a  moist  branch  on  forest  floor  surrounded  by  Yellow  cedars,  Western  Hemlocks  and  Douglas  Firs.
DNA  sequence  in  GeneBank CATTATTGAATTTTTGAAGGAGCTGTTTGCTGGCCTCTAGCGGGGCATGTGCACG  CTTTGTTCAAAATCCAACCTTTCATACCCCTGTGCACCTTTTGTAGGGTCGTGGC  TGTGAGGCTGCGCTCTATGTTTATCATTAAACTCTTCAGTATGTGTAGAATGACG  CTGCGTGTAACGCATTTTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCA  TCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGA  ATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCT  GTTTGAGTGTCATGGAACCATCAACCTCTTATCTTTGTTTTACATTGACGAGAAG  GCTTGGACTTGGAGGCTTTGCCGGTTTTGGTTTGACCGATCGGCTCCTCTTGAAT  GCATTAGCTTGAACCTATGCCGTAGCGGCTGTTCGGTGTGATAATTGTCTACGCC  GTGGCTGTGAGGCTATAAAATTGTAGGATCAGCTTCGAACTGTCCCTCGCGACAA  CATCTTAATTGACC
Name  of  Sequencer Simon  Mattern
Specimen Images
Image of PA282435.jpeg
Cap  shape  when  mature 5 globular
phylum Basidiomycota
material  collected pored  wood  decay  fungus
morphology  summary Material  collected:  pored  wood  decay  fungus
Habit:  3  compact  clumps
Color  of  top  surface:  1  white
Secondary  color  top  surface:  1  white
Spore  print  color:  17  none  -  no  stains  or  not  applicable
Hymenium  color  when  young:  1  white
Hymenium  color  when  mature:  1  white
Spore  length:  12
Spore  width:  5
Smell:  2  mild/none
Taste:  2  bitter
Flesh  hardness:  2  firm,  fleshy
Cap  shape  when  mature:  5 globular
Cap  shape  in  center:  1  raised
Cap  shape  from  above:  2  irregular
Cap  color  with  age:  1  white
Cap  stain  color:  17  none  -  no  stains  or  not  applicable
Cap  width:  17
Cap  surface  texture:  2  smooth
Cap  stickiness:  1  dry
Cap  has  concentric  zones  of  color:  No
Cap  hygrophanous:  No
Cap  flesh  color:  1  white
Cap  flesh  stain  color:  17  none  -  no  stains  or  not  applicable
Flesh  toughness:  3  tough  -  does  not  tear  easily
Flesh  fracture:  2  irregular  tear
Cap  cross  section:  1  upturned
Cap  edge:  2  wavy  or  lobed
Hymenium  stain  color:  17  none  -  no  stains  or  not  applicable
Latex  color:  17  none  -  no  stains  or  not  applicable
Latex  stain  color:  17  none  -  no  stains  or  not  applicable
Reaction  ammonia  color:  17  none  -  no  stains  or  not  applicable
Spore  shape:  6  circular
Spore  ornamentation:  none
Time  Modified 20:50:49
Date  Created 06/11/2023
mycology project ID 966