Browse Record

Family Mycenaceae
Accession Number F035894
Genus Panellus
Species longinquus
Species Author Singer  (Berk.)
Country Canada
Province_State British  Columbia
Location Near  Trans  Canada  Trail
Capilano  River  Regional  Park,
5077  Capilano  Rd.,
North  Vancouver
7VR  4K4
Latitude 49.35737
Longitude -123.11157
Altitude 70  m
Date 28/10/2023    (DD/MM/YYYY)
GeneBank Accession Number PP550917
Morphological Description Growing  on  the  sides  of  the  log,  other  shelf  mushrooms  on  the  same  log.
Color:  Brown
Surface:  Moist
Veil  remnants:  None
Margin:  Uplifted
Odor:  Earthy  mushroom,  relatively  strong
Latex:  Transparent,  small  amount,  leaves  slight  film  on  hands
Hymenphore:  light  brown
Mature:  light  brown
Attachment:  Adnate
Spacing:  close
Thickness:  Moderate
Consistency:  fleshy
Margin:  even
Lamellulae:  yes,  truncate
Stipe:  None/sessile
Partial  veil:  None
Universal  veil:  None
Bruising/staining:  turned  darker  brown  after  harvesting
Strong  earthy  smell

Spores
Yellow
Amyloid
Bean  shaped
Smooth,  no  ornamentation
7-9  µm  x  3-5  µm
Thick  walls

Cheilocystidia
Seaweed-like  shape
Clear,  lightly  yellow
35-50  µm  x  2.5-5  µm
Collector Dagny  Lin
Number FF042810
Other Collectors Azalea  Redfern,  Lucas  Braun,  Kania  Sugiarto
Determined by Kania  Sugiarto
Host Substratum Dead  Log
Notes
Habitat Dead  Log,  potentially  alder?
DNA  sequence  in  GeneBank CATTACTGAAGTTGAGGGTTGCAGCTGGCTCTTCTGAGTATGTGCTCGCCCTTTCTTTCTTACCACCTGTGCACCTTTTGTAGGCTATGATGAACTTGTCAGTTGAAAGACTGGTTTTGAGGGTTTGCTTTTGGGCTTCCCTTGCTTGTCATGGCTTATGTCTTTACAAACTCAAAATGTTATGAATGTCTTATATGGGTTTTTACCCTATAAACTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACCTCAATCAGTTTTCGAGCTGGCTGAGGCTTTGGACGTGGAGGCTTTGCTGGACTCTCAGAGATCAGCTCCTCTTAAATGCATTAGCGGTTACTGATCCCATTCATTGGTGTGATAATTATCTATGCCTTTGGTGGTTTCTTATGTATCAGCTTCTAACCGTCCTCTAGTAGGACAATTTATTGACTATTTGACC
Name  of  Sequencer Kania  Sugiarto
Specimen Images
Image of PA282497.jpeg
Image of PA282496.jpeg
Image of PA282495.jpeg
Image of PA282494.jpeg
Image of PA282493.jpeg
Image of PA282492.jpeg
Cap  shape  when  mature 3 convex  to  plane
phylum Basidiomycota
material  collected gilled  mushroom
morphology  summary Material  collected:  gilled  mushroom
Habit:  2  numerous  or  trooping,  but  not  in  clumps
Color  of  top  surface:  11  dark  brown
Secondary  color  top  surface:  8  tan  -  light  brown
Spore  print  color:  17  none  -  no  stains  or  not  applicable
Hymenium  color  when  young:  17  none  -  no  stains  or  not  applicable
Hymenium  color  when  mature:  17  none  -  no  stains  or  not  applicable
Spore  length:  8.5
Spore  width:  4
Smell:  6  other
Flesh  hardness:  1  soft-spongy,  including  gelatinous
Cap  shape  when  mature:  3 convex  to  plane
Cap  shape  from  above:  3  fan  or  tongue  shape
Cap  color  with  age:  11  dark  brown
Cap  stain  color:  17  none  -  no  stains  or  not  applicable
Cap  surface  texture:  3  rough,  wrinkled,  cracked,  warts
Cap  stickiness:  3  sticky  or  slimy  when  wet
Cap  has  concentric  zones  of  color:  No
Cap  stalk  easily  part:  No
Cap  flesh  color:  8  tan  -  light  brown
Cap  flesh  stain  color:  17  none  -  no  stains  or  not  applicable
Flesh  toughness:  2  easy  to  break  or  tear,  but  not  fragile
Flesh  fracture:  3  fibrous-tears  easier  in  one  direction
Cap  margin  surface:  1  pleated,  grooved,  streaked,  or  ribbed(edge)
Cap  edge:  3  scalloped
Hymenium  stain  color:  17  none  -  no  stains  or  not  applicable
Latex  color:  17  none  -  no  stains  or  not  applicable
Latex  stain  color:  17  none  -  no  stains  or  not  applicable
Reaction  Melzer's  color:  2  light  gray
Spore  shape:  1  bean  shaped
Spore  ornamentation:  none
cystidia:  Cheilocystidia,  seaweed  like
Time  Modified 20:50:49
Date  Created 06/11/2023
mycology project ID 975