Browse Record

Family Russulaceae
Accession Number F035899
Genus Russula 
Species emetica 
Species Author (Schaeff.)  Pers.
Country   Canada 
Province_State British  Columbia
Location
Latitude 49.357
Longitude -123.1125 
Altitude 90  m
Date 28/10/2023    (DD/MM/YYYY)
GeneBank Accession Number PP550924
Morphological Description vanilla  odor,  peppery  taste,  white  solid  stalk  and  slightly  browning  or  yellowing  cap,  does  not  bruise  easily,  soft  and  brittle,  surface  shiny  when  wet  and  dull  when  dry,  white  equidistant  gills  that  are  moderately  thick,  no  lamellulae,  brownish  margin,  smooth  pileus  texture  that  is  slimy  when  wet,  whole  decurved  margin,  no  latex,  central  solid  stipe  that  is  brittle  and  white,  fusiform  in  shape,  smooth  surface,  white  flesh
magnified  study  revealed  white  spore  print  that  has  warty  ornamentation,  spore  ornamentation  stains  blue  with  Melzers,  spores  are  thin-walled  with  presence  of  cystidia,
Collector Kalen  Dofher
Number KD2810202307
Other Collectors Daniyal  Khuhro,  Gia  Khanna
Determined by Daniyal  Khuhro
Host Substratum On  moist  soil  near  the  mossy  base  of  a  Douglas  fir
Notes mushroom  turned  black  in  drier,  only  able  to  find  young  species  of  mushroom
Habitat Growing  near  the  base  of  a  large  Douglas  Fir,  surrounding  area  of  growth  was  mossy,  appeared  to  be  growing  through  the  sphagnum  moss 
DNA  sequence  in  GeneBank CATTATCGTAAAACCGAGGTGCGAGGGCTGTCGCTGACCTTTTCGGTCGTGCACGCCCGAGTGCTCTCACACAATCCATCTCACCCCTTGTGCACCACCGCGTGGGTCCCTCTCTGGCTCGTCCGGAGGGGGGCTCGCGTTTTCACACAAACTTGAAGTAGTGTAGAATGTCCTTTTTTGCGATAACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATTCTCAAAACCCTTTCTTTTGGTCATTTTTGACCATGGAAAGGATTTTGGACTTGGAGGCCTTTTTGCTGGTTTCAACCTTGAAGCGAGCTCCTCCCAAATGTATTAGTGGGGTCTGCATTGTCGGTCCTTGGCGTGATAAGTTGTTTCTACGTCTTGGATTTTTGGCGCTGTACACCTGCTTCTAACCGTCTCATTGACAACGATGGTGTTCCGGTCGCCGCCGATTTTTCGGTGGGAGGCTTGACCCACGAAACAAACCTTGACC
Name  of  Sequencer
Specimen Images
Image of PA282565.jpeg
Cap  shape  when  mature
phylum Basidiomycota
material  collected gilled  mushroom
morphology  summary Material  collected:  gilled  mushroom
Habit:  1  solitary  or  scattered
Color  of  top  surface:  3  pale  yellow  or  cream
Secondary  color  top  surface:  17  none  -  no  stains  or  not  applicable
Spore  print  color:  1  white
Hymenium  color  when  young:  1  white
Hymenium  color  when  mature:  17  none  -  no  stains  or  not  applicable
Spore  length:  49
Spore  width:  49
Smell:  1  anise,  fruity,  sweet
Taste:  1  acrid/peppery
Flesh  hardness:  1  soft-spongy,  including  gelatinous
Cap  shape  in  center:  2  even  or  flat
Cap  shape  from  above:  1  circular-even  if  wavy
Cap  color  with  age:  3  pale  yellow  or  cream
Cap  stain  color:  17  none  -  no  stains  or  not  applicable
Cap  width:  1320
Cap  surface  texture:  2  smooth
Cap  stickiness:  3  sticky  or  slimy  when  wet
Cap  has  concentric  zones  of  color:  No
Cap  stalk  easily  part:  Yes
Cap  hygrophanous:  No
Cap  flesh  color:  1  white
Cap  flesh  stain  color:  17  none  -  no  stains  or  not  applicable
Flesh  toughness:  2  easy  to  break  or  tear,  but  not  fragile
Flesh  fracture:  4  brittle  or  crumbly
Cap  cross  section:  2  recurved
Cap  margin  surface:  2  smooth
Cap  edge:  1  smooth
Stipe  shape:  3  equal
Stipe  core:  1  solid
Stipe  position:  1  central
Stipe  flesh  hardness:  1  soft-spongy,  including  gelatinous
Stipe  flesh  toughness:  2  easy  to  break  or  tear,  but  not  fragile
Stipe  flesh  fracture:  4  brittle  or  crumbly
Stipe  flesh  color:  1  white
Stipe  flesh  stain  color:  17  none  -  no  stains  or  not  applicable
Stipe  primary  color:  1  white
Stipe  secondary  color:  17  none  -  no  stains  or  not  applicable
Stipe  stain  color:  17  none  -  no  stains  or  not  applicable
Stipe  surface  texture:  10  smooth
Stipe  width:  310
Stipe  length:  2032
Gill  attachment:  1  adnate
Gill  collarium:  No
Gill  sawtooth  edge:  No
Hymenium  stain  color:  17  none  -  no  stains  or  not  applicable
Gills  break  from  cap:  No
Gills  deliquescent:  No
Gills  mottled  face:  No
Gills  secede  from  stalk:  No
Gills  waxy  feel:  No
Gills  anastomosing:  No
Gills  forked:  No
Ring  type:  5  none
Partial  veil  type:  5  none
Ring  location  on  stalk:  5  none
Ring  number:  3  none
Ring  color:  17  none  -  no  stains  or  not  applicable
Volva  type:  6  none
Volva  color:  17  none  -  no  stains  or  not  applicable
Latex  color:  17  none  -  no  stains  or  not  applicable
Latex  stain  color:  17  none  -  no  stains  or  not  applicable
Reaction  ammonia  color:  17  none  -  no  stains  or  not  applicable
Reaction  Fe.  Sul.  color:  17  none  -  no  stains  or  not  applicable
Reaction  Melzer's  color:  17  none  -  no  stains  or  not  applicable
Reaction  potassium:  17  none  -  no  stains  or  not  applicable
Spore  shape:  6  circular
Spore  ornamentation:  warty  ornamentation,  blue  in  Melzer's
cystidia:  Present  as  Pleuro  and  Cheilocystidia
clamp  connections:  Not  seen 
cap  cuticle  type:  Not  looked  for
trama  type:  No  specific  orientation  or  distinguishing  features
Time  Modified 20:50:49
Date  Created 06/11/2023
mycology project ID 979