Browse Record

Family Pluteaceae
Accession Number
Genus Pluteus
Species atromarginatus 
Species Author
Country Canada
Province_State British  Columbia
Location Capilano  River  Regional  Park  (river  and  hatchery).  At  the  junction  of  the  second  canyon  trail.
Latitude 49.3571
Longitude -123.11111
Altitude 65  m
Date 20/10/2024    (DD/MM/YYYY)
GeneBank Accession Number
Morphological Description The  gills  have  black  edges  along  the  entirety  of  each  gill.  The  stem  is  white  and  has  no  ring,  with  brown-grey  longitudinal  striation,  more  at  the  top  near  cap.  The  cap  is  convex,  smooth/slimy,  dark  brown  and  about  ~2-2.5  inches  in  diameter.  The  spores  are  a  salmon  colour,  the  pleurocystidia  vary  in  shape  from  antlered  to  flask  shaped,  and  the  cap  pillus  is  trichopalisade.
Collector Gabby  Tedesco
Number gt2024Oct19.1
Other Collectors Mehmet  Eyüboglu,  Ceili  Clark,  Annica  Constantin
Determined by Gabrielle  Tedesco
Host Substratum Dead  tree  and  moss
Notes Smooth/slimy  dark  brown  convex  cap.  Free  broad  gills  with  straight  margin.  Forking  marginate  gills  with  white  face  and  brown/black  edges  (white  face  turned  grey/salmon  after  one  day).  Centred  white  stem  with  light  brown  lateral  striation  and  a  clavate  base.  Spores  (~5micrometers)  are  salmon  in  colour  and  have  an  apical  pore  and  no  ornamentation.  Have  trichopalisade  cap  pellis  and  variation  of  antlered  and  flask  shaped  cystidia.  Has  slight  earthy  smell.
Habitat On  a  fallen  tree  in  forest  (Capilano  Regional  Park  across  from  Hatchery)
DNA  sequence  in  GeneBank CATTATTGAATAAACAGTGTGGGTTGTTGCTGGCCTTCTGGTATGTGCACGCCTGCCATATGTTTCATTCCCTTCTTTCCACCTGTGCACTATGTGTAGACTATGTATGCTGTATTGTCAGGCCCTTCATAAGGCTTGGTTTAGAGAGGATGCTTGTCTTTATGAGACAGGCTCATCTTGGGCGTACAGGTCTATGTTTTACACCAACACGAATGTCTTAGAATGTATTTTTTCAGGCTCTTGCTAGCCTTTAAACCATATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAATCCCCTTCAATTTTGTATTGTTGGGTGATGGACTATGGGAGCCTGCTGGCATCGTTCAGCTCTCCTCAAATGCATTAGCAGGGTAATATGCCATCTGTGCTTGGTATGATATTTATCTATACCTCATGTGCTCATGTCTTACTTGCTTCAAACTGTTGCTTCAAGCAACACTTTTTGACC
Name  of  Sequencer Gabrielle  Tedesco
Specimen Images
Image of 2024_10_PA0462.JPG
Cap  shape  when  mature 3 convex  to  plane
phylum Basidiomycota
material  collected gilled  mushroom
morphology  summary Material  collected:  gilled  mushroom
Habit:  1  solitary  or  scattered
Color  of  top  surface:  11  dark  brown
Secondary  color  top  surface:  17  none  -  no  stains  or  not  applicable
Spore  print  color:  6  pink  or  salmon
Spore  length:  5
Spore  width:  4
Smell:  2  mild/none
Flesh  hardness:  2  firm,  fleshy
Cap  shape  when  mature:  3 convex  to  plane
Cap  shape  in  center:  2  even  or  flat
Cap  shape  from  above:  1  circular-even  if  wavy
Cap  color  with  age:  11  dark  brown
Cap  stain  color:  17  none  -  no  stains  or  not  applicable
Cap  width:  63.5
Cap  surface  texture:  2  smooth
Cap  stickiness:  3  sticky  or  slimy  when  wet
Cap  has  concentric  zones  of  color:  No
Cap  stalk  easily  part:  Yes
Cap  hygrophanous:  No
Cap  flesh  color:  3  pale  yellow  or  cream
Cap  flesh  stain  color:  17  none  -  no  stains  or  not  applicable
Flesh  toughness:  2  easy  to  break  or  tear,  but  not  fragile
Flesh  fracture:  3  fibrous-tears  easier  in  one  direction
Cap  cross  section:  3  incurved
Cap  margin  surface:  2  smooth
Cap  edge:  1  smooth
Stipe  shape:  3  equal
Stipe  core:  1  solid
Stipe  position:  1  central
Stipe  flesh  hardness:  3  hard,  potato-like
Stipe  flesh  color:  1  white
Stipe  primary  color:  1  white
Stipe  secondary  color:  9  brown-  use  when  other  browns  do  not  fit
Stipe  surface  texture:  8  fibrilose
Stipe  width:  10.6
Gill  attachment:  5  free
Gill  sawtooth  edge:  No
Gills  break  from  cap:  No
Gills  mottled  face:  No
Gills  forked:  Yes
Ring  type:  5  none
Partial  veil  type:  5  none
Ring  location  on  stalk:  5  none
Ring  number:  3  none
Ring  color:  17  none  -  no  stains  or  not  applicable
Volva  type:  6  none
Volva  color:  17  none  -  no  stains  or  not  applicable
Spore  shape:  3  elliptical
Spore  ornamentation:  none
cystidia:  Antlered  and  flask  shaped
Time  Modified 15:05:40
Date  Created 20/10/2024
mycology project ID 1033