Family |
Crepidotaceae |
Accession Number |
|
Genus |
Crepidotus |
Species |
Versutus |
Species Author |
(Peck) Sacc. |
Country |
Canada |
Province_State |
British Columbia |
Location |
Capilano Regional Park, Second Canyon trail between Pipeline trail and Giant Fir Trail |
Latitude |
49.3567 |
Longitude |
-123.1116 |
Altitude |
85 m |
Date |
23/10/2021 (DD/MM/YYYY)
|
GeneBank Accession Number |
|
Morphological Description |
white gilled caps, growing straight out of wood with no stipe, no smell or taste, width 2-20mm, cap thickness 1-6mm, no evidence of partial or universal veil, even & smooth cap shape, nearly all spores 10x5mm in size & ovoid shape |
Collector |
Natalie Roche |
Number |
NKSY26 |
Other Collectors |
Kati Hruska, Yvonne Chan, Sarah-Isabelle Radziszewski |
Determined by |
Natalie Roche |
Host Substratum |
Growing out of chopped up coniferous log, hard wood w/ no bark |
Notes |
|
Habitat |
Temperate coniferous rainforest |
DNA sequence in GeneBank |
CATTAACGAATAAACCTGATGGACTGTCGCTGGCTCTCTAGGGAGCATGTGCACGCCTGTCATCTTTATCTTTCCACCTGTGCACATTTTGTAGACCTGGAGAAACATTTCTGAGGCAACTCAGTTGTGAGGAGTTTGCAGGCGTAAAGTCAGCTCTCCTTGAGTATCCAGGTTTATGTCTTTCATATACACCAATGAAATGTAATAGAATGTATCAATGGGTCTTTGTACCTATAATAAACTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACCAGCTTTGCTGTTGGTTTGGCTTGGATGTGGGGGTATTTTGCAGGCTTTCACAAGTCAGCTCCCCTGAAATGTATTAGCGGTACCCTTGTGGTTAACGGCTACTGGTGTGATAATTATCTACGCCATTAGACGCCCACGTATATATGGGGGTTATGCTGCTTCTAACAGTCCATTGACTTGGACAAACTACAATGACAATTTTGACC |
Name of Sequencer |
|
Specimen Images
|
|
Cap shape when mature |
1 conical/bell shape |
phylum |
Basidiomycota |
material collected |
gilled mushroom |
morphology summary |
Material collected: gilled mushroom
Habit: 2 numerous or trooping, but not in clumps
Color of top surface: 1 white
Secondary color top surface: 17 none - no stains or not applicable
Spore print color: 1 white
Spore length: 10
Spore width: 5
Smell: 2 mild/none
Taste: 3 mild/none
Flesh hardness: 2 firm, fleshy
Cap shape when mature: 1 conical/bell shape
Cap shape from above: 3 fan or tongue shape
Cap width: 10
Cap surface texture: 2 smooth
Cap stickiness: 1 dry
Cap has concentric zones of color: No
Flesh toughness: 2 easy to break or tear, but not fragile
Cap edge: 1 smooth
Gill attachment: 5 free
Partial veil type: 5 none
Spore shape: 2 cylindrical
clamp connections: none |
Time Modified |
19:50:59 |
Date Created |
12/12/2024 |
mycology project ID
|
1064 |