Browse Record

Family Crepidotaceae
Accession Number F038675
Genus Crepidotus
Species Versutus
Species Author (Peck)  Sacc.
Country Canada
Province_State British  Columbia
Location Capilano  Regional  Park,    Second  Canyon  trail  between  Pipeline  trail  and  Giant  Fir  Trail
Latitude 49.3567
Longitude -123.1116
Altitude 85  m
Date 23/10/2021    (DD/MM/YYYY)
GeneBank Accession Number PV839161
Morphological Description white  gilled  caps,  growing  straight  out  of  wood  with  no  stipe,  no  smell  or  taste,  width  2-20mm,  cap  thickness  1-6mm,  no  evidence  of  partial  or  universal  veil,  even  &  smooth  cap  shape,  nearly  all  spores  10x5mm  in  size  &  ovoid  shape
Collector Natalie  Roche
Number NKSY26
Other Collectors Kati  Hruska,  Yvonne  Chan,  Sarah-Isabelle  Radziszewski
Determined by Natalie  Roche
Host Substratum Growing  out  of  chopped  up  coniferous  log,  hard  wood  w/  no  bark
Notes
Habitat Temperate  coniferous  rainforest 
DNA  sequence  in  GeneBank CATTAACGAATAAACCTGATGGACTGTCGCTGGCTCTCTAGGGAGCATGTGCACGCCTGTCATCTTTATCTTTCCACCTGTGCACATTTTGTAGACCTGGAGAAACATTTCTGAGGCAACTCAGTTGTGAGGAGTTTGCAGGCGTAAAGTCAGCTCTCCTTGAGTATCCAGGTTTATGTCTTTCATATACACCAATGAAATGTAATAGAATGTATCAATGGGTCTTTGTACCTATAATAAACTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACCAGCTTTGCTGTTGGTTTGGCTTGGATGTGGGGGTATTTTGCAGGCTTTCACAAGTCAGCTCCCCTGAAATGTATTAGCGGTACCCTTGTGGTTAACGGCTACTGGTGTGATAATTATCTACGCCATTAGACGCCCACGTATATATGGGGGTTATGCTGCTTCTAACAGTCCATTGACTTGGACAAACTACAATGACAATTTTGACC
Name  of  Sequencer
Specimen Images
Image of 2024_10_PA0841.JPG
Image of 2024_10_PA0827.JPG
Image of 2024_10_PA0802.JPG
Image of 2024_10_PA0798.JPG
Cap  shape  when  mature 1 conical/bell  shape
phylum Basidiomycota
material  collected gilled  mushroom
morphology  summary Material  collected:  gilled  mushroom
Habit:  2  numerous  or  trooping,  but  not  in  clumps
Color  of  top  surface:  1  white
Secondary  color  top  surface:  17  none  -  no  stains  or  not  applicable
Spore  print  color:  1  white
Spore  length:  10
Spore  width:  5
Smell:  2  mild/none
Taste:  3  mild/none
Flesh  hardness:  2  firm,  fleshy
Cap  shape  when  mature:  1 conical/bell  shape
Cap  shape  from  above:  3  fan  or  tongue  shape
Cap  width:  10
Cap  surface  texture:  2  smooth
Cap  stickiness:  1  dry
Cap  has  concentric  zones  of  color:  No
Flesh  toughness:  2  easy  to  break  or  tear,  but  not  fragile
Cap  edge:  1  smooth
Gill  attachment:  5  free
Partial  veil  type:  5  none
Spore  shape:  2  cylindrical
clamp  connections:  none
Time  Modified 22:15:09
Date  Created 12/12/2024
mycology project ID 1064