Browse Record

Family Tricholomataceae
Accession Number
Genus Clitocybe
Species dilatata
Species Author Pers.  ex  Karst.
Country Canada
Province_State British  Columbia
Location Capilano  River  Regional  Park,  North  Vancouver
Latitude N  49  21.38
Longitude W  123  06.64
Altitude <  100  m
Date 27/10/2001    (DD/MM/YYYY)
GeneBank Accession Number
Morphological Description Cap:    some  fan  shaped  (from  above);  approximately  0.5  cm  thick  at  centre;  very  fine  grain

Gills:    of  unequal  length  (not  all  reach  stipe;  some  free);  slightly  darker  than  rest  of  mushroom;  average  thickness;  spacing  is  close;  yellowish  when  dried

Stipe:    slightly  pinched  at  bottom;  some  flexous;  breaks  vertically;  base  almost  twice  as  thick  as  apex

General:    pileus  and  stipe  concolourous;  extremely  withered  upon  drying  (about  half  original  dimensions);  inamyloid;  does  not  change  colour  upon  bruising
Collector Sean  McIsaac
Number 1
Other Collectors None
Determined by Sean  McIsaac
Host Substratum
Notes Specimen  originally  determined  to  be  Clitocybe  cerussata.  Because  C.  dilitata  is  common  on  the  disturbed  trail  sides  at  this  site,  it  seemed  likely  that  the  specimen  is  that  species.   

Spore  print  determined  spore  colour  to  be  white,  but  print  lost.

Submitting  the  full  TW13  sequence  to  NCBI's  BLAST  resulted  in  the  nearest  match:

>gi|4105005|gb|AF042590.1|  Clitocybe  connata  isolate  JM90c  25S  large  subunit  ribosomal  RNA
                      gene,  partial  sequence
                    Length  =  977

  Score  =  36.2  bits  (18),  Expect  =  1.4
  Identities  =  43/52  (82%),  Gaps  =  1/52  (1%)
  Strand  =  Plus  /  Minus

                                                                                                                             
Query:  353  accacccntttagagctgcnttcncangcancttgactctnttgngagcgca  404
                      |||||||  |||||||||||  |||  ||    ||  ||  ||||||  |||  |||||||
Sbjct:  278  accacccatttagagctgcattcccaaacaactcgactct-ttgagagcgca  228

This  was  the  only  representative  of  any  suspected  genera  to  appear.
Habitat Side  of  trail.  Mix  of  dirt/woodchip/gravel.    Bed  of  moss.    Underneath  conifers.
DNA  sequence  in  GeneBank
Name  of  Sequencer
Specimen Images
Image of 2001Sean_DNADSCN4607.JPG
Cap  shape  when  mature 3 convex  to  plane
phylum Basidiomycota
material  collected gilled  mushroom
morphology  summary Material  collected:  gilled  mushroom
Habit:  2  numerous  or  trooping,  but  not  in  clumps
Color  of  top  surface:  1  white
Secondary  color  top  surface:  2  light  gray
Spore  print  color:  1  white
Hymenium  color  when  young:  3  pale  yellow  or  cream
Hymenium  color  when  mature:  3  pale  yellow  or  cream
Spore  length:  4.56
Spore  width:  3.04
Smell:  2  mild/none
Flesh  hardness:  2  firm,  fleshy
Cap  shape  when  mature:  3 convex  to  plane
Cap  shape  in  center:  1  raised
Cap  shape  from  above:  1  circular-even  if  wavy
Cap  color  with  age:  1  white
Cap  width:  5
Cap  surface  texture:  2  smooth
Cap  stickiness:  1  dry
Cap  has  concentric  zones  of  color:  No
Cap  stalk  easily  part:  No
Cap  hygrophanous:  No
Cap  flesh  color:  1  white
Flesh  toughness:  2  easy  to  break  or  tear,  but  not  fragile
Flesh  fracture:  3  fibrous-tears  easier  in  one  direction
Cap  cross  section:  3  incurved
Cap  margin  surface:  2  smooth
Cap  edge:  2  wavy  or  lobed
Stipe  shape:  2  clavate
Stipe  core:  3  pithy
Stipe  position:  1  central
Stipe  flesh  hardness:  2  firm,  fleshy
Stipe  flesh  toughness:  2  easy  to  break  or  tear,  but  not  fragile
Stipe  flesh  fracture:  3  fibrous-tears  easier  in  one  direction
Stipe  flesh  color:  1  white
Stipe  primary  color:  1  white
Stipe  secondary  color:  2  light  gray
Stipe  surface  texture:  10  smooth
Stipe  width:  1
Stipe  length:  60
Gill  attachment:  1  adnate
Gill  collarium:  No
Gill  sawtooth  edge:  No
Hymenium  stain  color:  9  brown-  use  when  other  browns  do  not  fit
Gills  break  from  cap:  No
Gills  deliquescent:  No
Gills  mottled  face:  No
Gills  secede  from  stalk:  No
Gills  waxy  feel:  No
Gills  anastomosing:  No
Gills  forked:  No
Ring  type:  5  none
Partial  veil  type:  5  none
Ring  location  on  stalk:  5  none
Ring  number:  3  none
Ring  color:  17  none  -  no  stains  or  not  applicable
Volva  type:  6  none
Volva  color:  17  none  -  no  stains  or  not  applicable
Latex  color:  17  none  -  no  stains  or  not  applicable
Reaction  Melzer's  color:  9  brown-  use  when  other  browns  do  not  fit
Spore  shape:  3  elliptical
Spore  ornamentation:  1  smooth
cystidia:  None  observed
trama  type:  slighty  irregular  to  parallel
Time  Modified 11:16:13
Date  Created 26/11/2001
mycology project ID 73