Browse Record

Family Hydnangiaceae
Accession Number
Genus Laccaria
Species affin.  montana
Species Author Singer
Country Canada
Province_State British  Columbia
Location Between    Hatchery  and  Coho  Loop,  Capilano  River    Regional  park
Latitude 49.357195
Longitude -123.110391
Altitude 70  m
Date 28/10/2017    (DD/MM/YYYY)
GeneBank Accession Number
Morphological Description The  mushroom  appeared  to  be  medium  sized,  with  gills  that  were  spaced  moderately  apart.  The  stipe  length  varied  between  2.0  and  4.6  cm  among  individual  mushrooms.  Stipe  diameter  was  found  to  be  2.0  to  5.0  mm,  cap  diameter  2.0  to  3.7  cm,  and  full  length  varied  between  2.3  to  5.0  cm.  The  caps  were  convex  and  adnate  in  the  younger  specimens,  but  concave  and  seceding  in  the  older  ones.  The  mushrooms  were  a  faint  pink  or  salmon  colour  and  had  a  slight  orange  hue,  with  the  colour  transitioning  from  darkest  at  tip  of  cap  to  lighter  moving  outwards.  It  smelled  soapy  and  floral  when  freshly  picked,  and  tasted  chalk-like.  The  colour  became  duller  with  time,  but  did  not  change  much  otherwise.  The  spores  were  white,  and  average  spore  size  was  3  units  under  the  microscope  at  400x  magnification,  which  corresponds  to  approximately  10  µm.  Spores  were  globose  or  sub-globose  in  shape  with  spines,  and  basidia  had  4  basidiospores  each.
Collector Reva  Shenwai
Number 135618
Other Collectors
Determined by Reva  Shenwai
Host Substratum
Notes Sequence  closest  to  L.  montana  but  in  Wilson  et  al.  2013  Mycoscience,  comes  out  in  unnamed  clade  with  GMM7601  JX504144.  Close  to  D149865,    DQ149873
Habitat Under  mixed  conifers,  moss  on  a  grassy  patch  of  soil.
DNA  sequence  in  GeneBank CATTATTGAATAAACCTGATGTGACTGTTAGCTGGCTTTTCGAAGCATGTGCTCGTCCGTCATCTTTAATCTCTCCACCTGTGCACATTTTGTAGTCTTGGATACCTCTCGAGGCAACTCGGATTTTAGGATCGCCGTGCTGCACAAGTCGGCTTTCCTTTCATTTCCAAGACTATGTTTTTATATACACCAAAGTATGTTTAAAGAATGTCATCAATAGGAACTTGTTTCCTATAAAATTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTCCAGCTTTTATTAGCATGGTTAGGCTTGGATGTGGGGGTTGTGGGCTTCATCAATGAGGTCGGCTCTCCTTAAATGCATTAGCGGAACTTTTGTGGACCGTCTATTGGTGTGATAATTATCTACGCTGTGGATGTGAAGCAGATTTATGAAGTTCAGCTTCTAACTGTCCATTGACTTGGACAATTTTGACAATTTGACC
Name  of  Sequencer
Specimen Images
Image of 2017_Reva1.jpg
Cap  shape  when  mature 3 convex  to  plane
phylum Basidiomycota
material  collected gilled  mushroom
morphology  summary Material  collected:  gilled  mushroom
Habit:  3  compact  clumps
Color  of  top  surface:  6  pink  or  salmon
Secondary  color  top  surface:  5  orange
Spore  print  color:  1  white
Hymenium  color  when  young:  3  pale  yellow  or  cream
Hymenium  color  when  mature:  3  pale  yellow  or  cream
Spore  length:  10
Spore  width:  10
Smell:  1  anise,  fruity,  sweet
Taste:  3  mild/none
Flesh  hardness:  1  soft-spongy,  including  gelatinous
Cap  shape  when  mature:  3 convex  to  plane
Cap  shape  in  center:  2  even  or  flat
Cap  shape  from  above:  1  circular-even  if  wavy
Cap  color  with  age:  6  pink  or  salmon
Cap  stain  color:  17  none  -  no  stains  or  not  applicable
Cap  width:  18
Cap  surface  texture:  4  hairy,  include  velvety
Cap  stickiness:  5  moist  feel
Cap  has  concentric  zones  of  color:  Yes
Cap  stalk  easily  part:  No
Cap  hygrophanous:  Yes
Cap  flesh  color:  3  pale  yellow  or  cream
Cap  flesh  stain  color:  17  none  -  no  stains  or  not  applicable
Flesh  toughness:  3  tough  -  does  not  tear  easily
Flesh  fracture:  3  fibrous-tears  easier  in  one  direction
Cap  cross  section:  5  straight
Cap  margin  surface:  2  smooth
Cap  edge:  1  smooth
Stipe  shape:  2  clavate
Stipe  core:  1  solid
Stipe  position:  1  central
Stipe  flesh  hardness:  1  soft-spongy,  including  gelatinous
Stipe  flesh  toughness:  3  tough  -  does  not  tear  easily
Stipe  flesh  fracture:  3  fibrous-tears  easier  in  one  direction
Stipe  flesh  color:  3  pale  yellow  or  cream
Stipe  flesh  stain  color:  17  none  -  no  stains  or  not  applicable
Stipe  primary  color:  6  pink  or  salmon
Stipe  secondary  color:  1  white
Stipe  stain  color:  17  none  -  no  stains  or  not  applicable
Stipe  surface  texture:  10  smooth
Stipe  width:  4
Stipe  length:  37
Gill  attachment:  1  adnate
Gill  collarium:  Yes
Gill  sawtooth  edge:  No
Hymenium  stain  color:  17  none  -  no  stains  or  not  applicable
Gills  break  from  cap:  No
Gills  deliquescent:  No
Gills  mottled  face:  No
Gills  secede  from  stalk:  No
Gills  waxy  feel:  No
Gills  anastomosing:  No
Gills  forked:  Yes
Ring  type:  5  none
Partial  veil  type:  5  none
Ring  location  on  stalk:  5  none
Ring  number:  3  none
Ring  color:  17  none  -  no  stains  or  not  applicable
Volva  type:  6  none
Volva  color:  17  none  -  no  stains  or  not  applicable
Latex  color:  17  none  -  no  stains  or  not  applicable
Latex  stain  color:  17  none  -  no  stains  or  not  applicable
Reaction  ammonia  color:  17  none  -  no  stains  or  not  applicable
Reaction  Fe.  Sul.  color:  17  none  -  no  stains  or  not  applicable
Reaction  Melzer's  color:  17  none  -  no  stains  or  not  applicable
Reaction  potassium:  17  none  -  no  stains  or  not  applicable
Spore  shape:  6  circular
Spore  ornamentation:  spines
cystidia:  none  observed
clamp  connections:  none  observed
trama  type:  parallel
Time  Modified 09:11:26
Date  Created 31/10/2017
mycology project ID 677