Capilano River Regional Park, North Vancouver, BC Canada on the Palisades trail
Latitude
49.35727
Longitude
-123.10919
Altitude
100 m
Date
28/10/2017 (DD/MM/YYYY)
GeneBank Accession Number
MG953967
Morphological Description
Spore print: white
Underside: no gills, has teeth of variable sizes housing basidia
Collector
Anita Poon
Number
AP20172
Other Collectors
Jung Min (Lina) Lee, Elizabeth Lee, Xue Yin
Determined by
Anita Poon
Host Substratum
Protruding from decaying log
Notes
Small cluster of 6-10 bodies of various sizes; saprotrophic
DNA sequence:
CGTAGGTGACCCTGCGGAGGGATCATTAATGAATTCTCTTTGGCTGATGCGCCTCTGGGCTGCACGTCAAATAATTTCATCCACACACCCCTTGTGCACCTTTGGGACTTGGTAGCCCCTCGTGGGTCGCCTGTCCTCATTTTTTTCCACACCCTCCACAAAGTAACAGCATGTGCGAATTTATAAACAATGAAACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGCGTCACGTGAACATCTCGTCCATGTCATTGTAAAGTGGCATGGATGGGGATTTGGACTGTGCCGTCTCCCGGCTCGTCCTGAAATGCATTAGCTCGGTTTAAGCGACCGTCTCGGTGTGATTAAACATCTACGCCTTGGCCAAGTTGAACGGGCTCACAGCAACCCACATTTTTTACGCTCTGGCCTCAAATCAGGCAG
Habitat
Coniferous forest
DNA sequence in GeneBank
Name of Sequencer
Anita Poon
Specimen Images
Cap shape when mature
3 convex to plane
phylum
Basidiomycota
material collected
jelly fungus
morphology summary
Material collected: jelly fungus
Color of top surface: 9 brown- use when other browns do not fit
Secondary color top surface: 1 white
Spore print color: 1 white
Hymenium color when young: 1 white
Hymenium color when mature: 1 white
Spore length: 6
Spore width: 5.4
Smell: 2 mild/none
Taste: 3 mild/none
Flesh hardness: 1 soft-spongy, including gelatinous
Cap shape when mature: 3 convex to plane
Cap shape in center: 2 even or flat
Cap shape from above: 3 fan or tongue shape
Cap color with age: 9 brown- use when other browns do not fit
Cap stain color: 17 none - no stains or not applicable
Cap width: 36
Cap surface texture: 2 smooth
Cap stickiness: 5 moist feel
Cap has concentric zones of color: No
Cap stalk easily part: No
Cap flesh color: 1 white
Cap flesh stain color: 17 none - no stains or not applicable
Flesh toughness: 2 easy to break or tear, but not fragile
Flesh fracture: 1 jelly-like
Cap cross section: 5 straight
Stipe shape: 6 taper down
Stipe core: 1 solid
Stipe position: 1 central
Stipe flesh hardness: 1 soft-spongy, including gelatinous
Stipe flesh toughness: 2 easy to break or tear, but not fragile
Stipe flesh fracture: 1 jelly-like
Stipe flesh color: 1 white
Stipe flesh stain color: 17 none - no stains or not applicable
Stipe primary color: 1 white
Stipe secondary color: 17 none - no stains or not applicable
Stipe stain color: 17 none - no stains or not applicable
Stipe surface texture: 10 smooth
Stipe width: 15
Stipe length: 15
Hymenium stain color: 17 none - no stains or not applicable
Ring type: 5 none
Partial veil type: 5 none
Ring location on stalk: 5 none
Ring number: 3 none
Ring color: 17 none - no stains or not applicable
Volva type: 6 none
Volva color: 17 none - no stains or not applicable
Latex color: 17 none - no stains or not applicable
Latex stain color: 17 none - no stains or not applicable
Spore shape: 6 circular
Spore ornamentation: smooth
