Browse Record

Family Exidiaceae
Accession Number F33228
Genus Pseudohydnum
Species gelatinosum
Species Author (Scop.)  P.  Karst.
Country Canada
Province_State BC
Location Capilano  River  Regional  Park,  North  Vancouver,  BC  Canada  on  the  Palisades  trail
Latitude 49.35727
Longitude -123.10919
Altitude 100  m
Date 28/10/2017    (DD/MM/YYYY)
GeneBank Accession Number MG953967
Morphological Description Spore  print:  white
Underside:  no  gills,  has  teeth  of  variable  sizes  housing  basidia
Collector Anita  Poon
Number AP20172
Other Collectors Jung  Min  (Lina)  Lee,  Elizabeth  Lee,  Xue  Yin
Determined by Anita  Poon
Host Substratum Protruding  from  decaying  log
Notes Small  cluster  of  6-10  bodies  of  various  sizes;  saprotrophic

DNA  sequence:
CGTAGGTGACCCTGCGGAGGGATCATTAATGAATTCTCTTTGGCTGATGCGCCTCTGGGCTGCACGTCAAATAATTTCATCCACACACCCCTTGTGCACCTTTGGGACTTGGTAGCCCCTCGTGGGTCGCCTGTCCTCATTTTTTTCCACACCCTCCACAAAGTAACAGCATGTGCGAATTTATAAACAATGAAACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGCGTCACGTGAACATCTCGTCCATGTCATTGTAAAGTGGCATGGATGGGGATTTGGACTGTGCCGTCTCCCGGCTCGTCCTGAAATGCATTAGCTCGGTTTAAGCGACCGTCTCGGTGTGATTAAACATCTACGCCTTGGCCAAGTTGAACGGGCTCACAGCAACCCACATTTTTTACGCTCTGGCCTCAAATCAGGCAG
Habitat Coniferous  forest
DNA  sequence  in  GeneBank
Name  of  Sequencer Anita  Poon
Specimen Images
Image of 2017_Anita1.jpg
Cap  shape  when  mature 3¬†convex  to  plane
phylum Basidiomycota
material  collected jelly  fungus
morphology  summary Material  collected:  jelly  fungus
Color  of  top  surface:  9  brown-  use  when  other  browns  do  not  fit
Secondary  color  top  surface:  1  white
Spore  print  color:  1  white
Hymenium  color  when  young:  1  white
Hymenium  color  when  mature:  1  white
Spore  length:  6
Spore  width:  5.4
Smell:  2  mild/none
Taste:  3  mild/none
Flesh  hardness:  1  soft-spongy,  including  gelatinous
Cap  shape  when  mature:  3¬†convex  to  plane
Cap  shape  in  center:  2  even  or  flat
Cap  shape  from  above:  3  fan  or  tongue  shape
Cap  color  with  age:  9  brown-  use  when  other  browns  do  not  fit
Cap  stain  color:  17  none  -  no  stains  or  not  applicable
Cap  width:  36
Cap  surface  texture:  2  smooth
Cap  stickiness:  5  moist  feel
Cap  has  concentric  zones  of  color:  No
Cap  stalk  easily  part:  No
Cap  flesh  color:  1  white
Cap  flesh  stain  color:  17  none  -  no  stains  or  not  applicable
Flesh  toughness:  2  easy  to  break  or  tear,  but  not  fragile
Flesh  fracture:  1  jelly-like
Cap  cross  section:  5  straight
Stipe  shape:  6  taper  down
Stipe  core:  1  solid
Stipe  position:  1  central
Stipe  flesh  hardness:  1  soft-spongy,  including  gelatinous
Stipe  flesh  toughness:  2  easy  to  break  or  tear,  but  not  fragile
Stipe  flesh  fracture:  1  jelly-like
Stipe  flesh  color:  1  white
Stipe  flesh  stain  color:  17  none  -  no  stains  or  not  applicable
Stipe  primary  color:  1  white
Stipe  secondary  color:  17  none  -  no  stains  or  not  applicable
Stipe  stain  color:  17  none  -  no  stains  or  not  applicable
Stipe  surface  texture:  10  smooth
Stipe  width:  15
Stipe  length:  15
Hymenium  stain  color:  17  none  -  no  stains  or  not  applicable
Ring  type:  5  none
Partial  veil  type:  5  none
Ring  location  on  stalk:  5  none
Ring  number:  3  none
Ring  color:  17  none  -  no  stains  or  not  applicable
Volva  type:  6  none
Volva  color:  17  none  -  no  stains  or  not  applicable
Latex  color:  17  none  -  no  stains  or  not  applicable
Latex  stain  color:  17  none  -  no  stains  or  not  applicable
Spore  shape:  6  circular
Spore  ornamentation:  smooth
Time  Modified 09:11:26
Date  Created 14/11/2017
mycology project ID 680