Browse Record

Family Bankeraceae
Accession Number F33237
Genus Phellodon
Species melaleucus
Species Author (Sw.  ex  Fr.)  P.  Karst.
Country Canada
Province_State British  Columbia
Location Capilano  River  Regional  Park,  along  the  Coho  Loop. 
Latitude 49.355111
Longitude -123.110444
Altitude 68  m
Date 28/10/2017    (DD/MM/YYYY)
GeneBank Accession Number MG554652
Morphological Description Feshy  toothed  mushroom.  Smell  of  dried  spices  or  curry.  Cap  surface  concave,  velvety  to  matted  with  concentric  zones  of    from  dark  purple  to  grey  in  the  center  to  white  on  the  margins;  surface  is  rough  and  lined  with  pits  and  ridges.  Hymenium  of  tooth-like  projections  that  don’t  appear  to  have  any  relation  to  the  positions  of  the  pits  or  ridges.  Cap  2  cm  in  diameter,  stipe  0.75  cm  tall.  Small  twigs  and  leaves  were  enveloped  in  the  fruiting  body

No  cystidi. 
Collector Reva  Shenwai
Number 135635 
Other Collectors Gavin  Gao,  Alistair  Mukiri,  Daniel  Bateson
Determined by Gavin  Gao
Host Substratum Soil 
Notes
Habitat Forest  floor,  in  the  soil  and  duff  of  Western  Hemlock. 
DNA  sequence  in  GeneBank CATTAGTGAAACGTTTGTCGAAAAGGGTTGTAGCTGGCCTCCTTTGGGGGCATGTGCACGCCTGGATCGCAAATTCCACCCTCCACACCTGTGCACATCCTGTAGCTTTGCGATGCTGATGATACGGATCCTCCGATTCGGACGCGTCCTTGGCTGCGAGCTTTTATTACACACACGTTTTGTCAAGTATTAGAATGTAACTGTAGCAGCGCGTAAAAGCGTGAAATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTCTCAACTGCCTTTATGGTGAAGTTGGATTTGGAGGATCTTGCTGGCGCTCTTCAATGAGCTTCGTCGGCTCCTCTCGAATGCATGAGCCTTCCTGTGCAACATTGTGAAGCGACTCTGATGTGATAATTATCTACGTTGGATGTTGTGTTTGCTTTGGGCACGAACGGATTGCAAAAACGCAGATTGCGTCCTGACAAATTCGACC
Name  of  Sequencer
Specimen Images
Image of 2017_Gavin1.jpg
Cap  shape  when  mature 2 funnel
phylum Basidiomycota
material  collected toothed  mushroom
morphology  summary Material  collected:  toothed  mushroom
Habit:  3  compact  clumps
Color  of  top  surface:  15  black  or  dark  gray
Secondary  color  top  surface:  14  purple,  violet,  or  lilac
Spore  print  color:  17  none  -  no  stains  or  not  applicable
Hymenium  color  when  young:  1  white
Hymenium  color  when  mature:  1  white
Spore  length:  3.8
Spore  width:  3.6
Smell:  6  other
Taste:  3  mild/none
Flesh  hardness:  4  very  hard,  woody
Cap  shape  when  mature:  2 funnel
Cap  shape  in  center:  3  depressed
Cap  shape  from  above:  2  irregular
Cap  color  with  age:  15  black  or  dark  gray
Cap  stain  color:  17  none  -  no  stains  or  not  applicable
Cap  width:  20
Cap  surface  texture:  3  rough,  wrinkled,  cracked,  warts
Cap  stickiness:  1  dry
Cap  has  concentric  zones  of  color:  Yes
Cap  stalk  easily  part:  No
Cap  hygrophanous:  Yes
Cap  flesh  color:  15  black  or  dark  gray
Cap  flesh  stain  color:  17  none  -  no  stains  or  not  applicable
Flesh  toughness:  4  very  tough  -  very  difficult  to  tear  by  hand
Flesh  fracture:  3  fibrous-tears  easier  in  one  direction
Cap  cross  section:  1  upturned
Cap  margin  surface:  2  smooth
Cap  edge:  2  wavy  or  lobed
Stipe  shape:  6  taper  down
Stipe  core:  1  solid
Stipe  position:  2  off-center
Stipe  flesh  hardness:  4  very  hard,  woody
Stipe  flesh  toughness:  4  very  tough  -  very  difficult  to  tear  by  hand
Stipe  flesh  fracture:  3  fibrous-tears  easier  in  one  direction
Stipe  flesh  color:  15  black  or  dark  gray
Stipe  flesh  stain  color:  17  none  -  no  stains  or  not  applicable
Stipe  primary  color:  15  black  or  dark  gray
Stipe  secondary  color:  2  light  gray
Stipe  stain  color:  17  none  -  no  stains  or  not  applicable
Stipe  surface  texture:  8  fibrilose
Stipe  width:  7.5
Stipe  length:  7.5
Hymenium  stain  color:  17  none  -  no  stains  or  not  applicable
Ring  type:  5  none
Partial  veil  type:  5  none
Ring  location  on  stalk:  5  none
Ring  number:  3  none
Ring  color:  17  none  -  no  stains  or  not  applicable
Volva  type:  6  none
Volva  color:  17  none  -  no  stains  or  not  applicable
Latex  color:  17  none  -  no  stains  or  not  applicable
Latex  stain  color:  17  none  -  no  stains  or  not  applicable
Reaction  ammonia  color:  17  none  -  no  stains  or  not  applicable
Reaction  Fe.  Sul.  color:  17  none  -  no  stains  or  not  applicable
Reaction  Melzer's  color:  17  none  -  no  stains  or  not  applicable
Reaction  potassium:  15  black  or  dark  gray
Spore  shape:  3  elliptical
Spore  ornamentation:  echinulate 
cystidia:  None  present 
clamp  connections:  None  present
Time  Modified 09:11:26
Date  Created 21/11/2017
mycology project ID 700