Browse Record

Family Tapinellaceae
Accession Number
Genus Tapinella
Species panuoides
Species Author   (Fr.)  E.-J.  Gilbert
Country Canada
Province_State British  Columbia
Location Capilano  River  Regional  Park  (4077  Capilano  Park  Rd  North  Vancouver,  BC  V7R  4L2).  On  the  steps  of  the  Pipeline  Trail.
Latitude 49.353725
Longitude -123.113401
Altitude 63.0  m
Date 20/10/2018    (DD/MM/YYYY)
GeneBank Accession Number
Morphological Description The  cap  of  the  mushroom  is  2.4-3.5  cm  across  and  is  fan  shaped  with  rolled  in  margins  and  fine  hairs  on  some  areas  of  the  cap,  while  other  areas  are  smooth.  Fungi  has  absent  stipe  and  absent  cystidia.  The  gills  radiate  outwards  from  the  attachment  point,  have  a  yellowish-beige  colour,  and  are  cross  veined  and  narrow.  There  is  a  light  odour  present,  and  the  taste  was  slightly  bitter.

Collector Jasleen  Johal
Number JKJ09
Other Collectors
Determined by Jasleen  Johal
Host Substratum soil  in  crevices  of  concrete  steps
Notes
Habitat
DNA  sequence  in  GeneBank CACCATGTGCACCTCTTGTAGGTCTTTCGANATCTATGTATTTTCATTATACCCCAATGTATGTTTAAAGAAAGTTTATCTTATTATTGCACGCGTTACTTTTGTATAAAAGTGA  TTGGGCAAGTAAGTTGTTTTACAACTTTCAGCNGAATGGATCTCTTGGCTCTNGCATCGATGAAGAACGCAGCGAATTGCGATATGTAANTGTGGATTGCAGATTTTCCGTGA  ATCATCGAATTTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGTATGCCTGTTTGAGTGTCATTAAATTCTCAACTCTATATATTTTTGTGTATAGATGTTGGATTGTGG  GGGATTATGCTGGCTTGTCAGCTCCTCTTAAATGCATTAGCAAAAGATAGTCTTGCAATTGTTAGTGTGATAATGATCGCTGC-TTTGACCGAGACACATAATCTTAGCTCATAGTCGTCTCTTATAAGACAACATATTGAAATTTTGAGATCTCATCTCAGG
Name  of  Sequencer
Specimen Images
Image of 18_323_johal_j_04.jpg
Image of 18_323_johal_j_01.jpg
Image of 18_323_johal_j_01.jpg
Cap  shape  when  mature 3 convex  to  plane
phylum Basidiomycota
material  collected gilled  mushroom
morphology  summary Material  collected:  gilled  mushroom
Habit:  3  compact  clumps
Color  of  top  surface:  8  tan  -  light  brown
Secondary  color  top  surface:  11  dark  brown
Spore  print  color:  3  pale  yellow  or  cream
Hymenium  color  when  young:  17  none  -  no  stains  or  not  applicable
Hymenium  color  when  mature:  17  none  -  no  stains  or  not  applicable
Spore  length:  5
Spore  width:  3
Smell:  2  mild/none
Taste:  7  other
Flesh  hardness:  2  firm,  fleshy
Cap  shape  when  mature:  3 convex  to  plane
Cap  shape  in  center:  2  even  or  flat
Cap  shape  from  above:  3  fan  or  tongue  shape
Cap  color  with  age:  8  tan  -  light  brown
Cap  stain  color:  11  dark  brown
Cap  width:  30
Cap  surface  texture:  4  hairy,  include  velvety
Cap  stickiness:  1  dry
Cap  has  concentric  zones  of  color:  No
Cap  hygrophanous:  No
Cap  flesh  color:  8  tan  -  light  brown
Cap  flesh  stain  color:  11  dark  brown
Flesh  toughness:  3  tough  -  does  not  tear  easily
Flesh  fracture:  2  irregular  tear
Cap  cross  section:  4  inrolled
Cap  margin  surface:  2  smooth
Cap  edge:  2  wavy  or  lobed
Gill  attachment:  3  decurrent
Gill  collarium:  No
Gill  sawtooth  edge:  No
Hymenium  stain  color:  17  none  -  no  stains  or  not  applicable
Gills  break  from  cap:  Yes
Gills  deliquescent:  No
Gills  mottled  face:  No
Gills  secede  from  stalk:  No
Gills  waxy  feel:  No
Gills  anastomosing:  Yes
Gills  forked:  Yes
Ring  type:  5  none
Partial  veil  type:  5  none
Ring  location  on  stalk:  5  none
Ring  number:  3  none
Ring  color:  17  none  -  no  stains  or  not  applicable
Volva  type:  6  none
Volva  color:  17  none  -  no  stains  or  not  applicable
Latex  color:  17  none  -  no  stains  or  not  applicable
Latex  stain  color:  17  none  -  no  stains  or  not  applicable
Reaction  ammonia  color:  17  none  -  no  stains  or  not  applicable
Reaction  Fe.  Sul.  color:  17  none  -  no  stains  or  not  applicable
Reaction  Melzer's  color:  17  none  -  no  stains  or  not  applicable
Reaction  potassium:  9  brown-  use  when  other  browns  do  not  fit
Spore  shape:  3  elliptical
Spore  ornamentation:  smooth
cystidia:  absent
Time  Modified 21:07:58
Date  Created 29/11/2018
mycology project ID 787