Browse Record

Family russulaceae
Accession Number
Genus lactarius
Species
Species Author
Country Canada
Province_State British  Columbia
Location Capilano  River  regional  park 
Latitude 49.344
Longitude -123.117
Altitude
Date 23/10/2021    (DD/MM/YYYY)
GeneBank Accession Number
Morphological Description When  picked,  the  cap  was  reddish  brown,  and  gills  and  stem  light  orange.  Producing  white  latex  from  gills.  No  staining.  Cap  size  varies  from  1.5-2.5  cm,  and  heigh  from  3-5cm.  The  cap  was  flat  and  depressed  in  middle.  Gill  attachment  was  decurrent  down  stem. 
Collector Lucie  Radnidge
Number LR2021OCT23
Other Collectors
Determined by
Host Substratum Hemlock  coniver
Notes found  in  duff  under  conifer
Habitat Mixed  forest 
DNA  sequence  in  GeneBank CATTATCGTACAAAATGTGAGGGGGCATGCAAGGGCTGTCGCTGACTTCAAAGTCGTGCACGCCCCGGGTGTGTCCCCTCACATAATAATCCATCTCACCCTTTGTGCATCACCGCGTGGGCGCCCTTTGGGATCATCTCGGAGGGGGCTCGCGTTTTCACACAAACCCCCCCCCCTTTTAAAAGTGTAGAATGACCTCATATATGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAACCTCAACCTCCTTGGTTTCTTCTGGAGACCAAAGCAGGCTTGGACTTTGGAGGCCTTTGCTGGTGCCTCTCTCTTTTGAAGTGCCAGCTCCTCTTAAACAAATTAGCAGGGTCCTCTTTGCTGATCCTCGACGTGTGATAAGATGTTTCCATGTCTTGGTTTCTGGCTCTGTCACCTTTTGGGACCCGCTTCTAACCGTCTGGACCTTGTGTCGAGACAATGTTCGAGCATGATGTCTCCCTTCTCGGGAAGCTCCCTCGACCCCACGAACCCTTGACCTCAAA
Name  of  Sequencer
Specimen Images
Image of 2021_Lucie_1.jpg
Cap  shape  when  mature 3¬†convex  to  plane
phylum Basidiomycota
material  collected gilled  mushroom
morphology  summary Material  collected:  gilled  mushroom
Habit:  1  solitary  or  scattered
Color  of  top  surface:  10  rust  brown  (reddish  brown)
Secondary  color  top  surface:  7  red
Spore  print  color:  3  pale  yellow  or  cream
Hymenium  color  when  young:  5  orange
Hymenium  color  when  mature:  5  orange
Spore  length:  6
Spore  width:  2
Smell:  2  mild/none
Taste:  1  acrid/peppery
Flesh  hardness:  1  soft-spongy,  including  gelatinous
Cap  shape  when  mature:  3¬†convex  to  plane
Cap  shape  in  center:  3  depressed
Cap  shape  from  above:  1  circular-even  if  wavy
Cap  stain  color:  17  none  -  no  stains  or  not  applicable
Cap  width:  20
Cap  surface  texture:  2  smooth
Cap  stickiness:  3  sticky  or  slimy  when  wet
Cap  flesh  stain  color:  17  none  -  no  stains  or  not  applicable
Flesh  toughness:  1  fragile  -  difficult  to  handle  without  damage
Flesh  fracture:  4  brittle  or  crumbly
Cap  edge:  2  wavy  or  lobed
Stipe  length:  40
Gill  attachment:  3  decurrent
Hymenium  stain  color:  17  none  -  no  stains  or  not  applicable
Latex  color:  1  white
Latex  stain  color:  17  none  -  no  stains  or  not  applicable
Reaction  Melzer's  color:  13  blue
Time  Modified 23:20:43
Date  Created 28/11/2021
mycology project ID 810