Colour:
Cap: dark brown/purplish at top umbo, fades to pale brown towards base
Stem: dark brown/purple, similar to cap umbo, darkest at base
Gills: milky/beige white
Gill edge: has dark brown/purple lining, and vessel-like patterns on gill tissue
No distinctive odour or taste.
Very dark brown, almost black when dried.
Other:
Cap base ruffled
Hollow stem
Microscopic Charateristics
Avg. spore size: 9 x 3.5 micrometers
Cystidia: long, pointed cheilocystida
Collector
Tonya Mo
Number
TM21OCT531
Other Collectors
Christine Sun, Alice Ma, Allison Dummel
Determined by
Tonya Mo
Host Substratum
on Quercus sp. (decayed Oak tree)
Notes
Margin of cap with overhanging, crenulate tissue.
Habitat
Temperate rain forest
DNA sequence in GeneBank
>Nucleotide_alignment_(modified)_consensus_sequence Alignment of 2 sequences: TanyaMo-ITS1F.ab1, TanyaMo-ITS4.ab1 (reversed) CATTATTGAATACGATTGGTACTGATGCTGGCTCTTCACTGAGCATGTGCTCGTCCATCTATTTATCTTCTCTTGTGCACATCTTGTGGTCTTTGTATTGAAACCTTTCGCATTCGTGCGGTCAGGGAGAATGTTAACCCTTCTCCTGCTTCTTCAAAGGCCATGTTTTCATATACACTATATAAAGTTACAGAATGTCTTTTAACGACTTGTGCTTGCACGGTCATTAAACCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCCTATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTATCAACCTTGCTCGCTTTTACTAGCTTGAGTTAGGCTTGGATGTGAGGGCTTTGCTGGCTTCCTTCAGTGGATGGTCTGCTCCCTTTAAATTCATTAGTGGGATCTCTTGTGGACCGTCACTTGGTGGTGATAATTATCTATGCCTATTGAC
Name of Sequencer
Genewiz
Specimen Images
Cap shape when mature
1 conical/bell shape
phylum
Basidiomycota
material collected
gilled mushroom
morphology summary
Material collected: gilled mushroom
Habit: 1 solitary or scattered
Color of top surface: 10 rust brown (reddish brown)
Secondary color top surface: 8 tan - light brown
Spore print color: 1 white
Spore length: 9
Spore width: 3.5
Smell: 2 mild/none
Taste: 3 mild/none
Flesh hardness: 1 soft-spongy, including gelatinous
Cap shape when mature: 1 conical/bell shape
Cap shape in center: 1 raised
Cap shape from above: 1 circular-even if wavy
Cap color with age: 11 dark brown
Cap stain color: 17 none - no stains or not applicable
Cap width: 1.8
Cap surface texture: 2 smooth
Cap stickiness: 1 dry
Cap has concentric zones of color: No
Cap stalk easily part: No
Cap hygrophanous: Yes
Cap flesh color: 1 white
Cap flesh stain color: 17 none - no stains or not applicable
Flesh toughness: 1 fragile - difficult to handle without damage
Flesh fracture: 3 fibrous-tears easier in one direction
Cap cross section: 5 straight
Cap margin surface: 1 pleated, grooved, streaked, or ribbed(edge)
Cap edge: 2 wavy or lobed
Stipe shape: 2 clavate
Stipe core: 2 hollow
Stipe position: 1 central
Stipe flesh hardness: 1 soft-spongy, including gelatinous
Stipe flesh toughness: 1 fragile - difficult to handle without damage
Stipe flesh fracture: 3 fibrous-tears easier in one direction
Stipe flesh color: 11 dark brown
Stipe flesh stain color: 17 none - no stains or not applicable
Stipe primary color: 11 dark brown
Stipe secondary color: 7 red
Stipe stain color: 7 red
Stipe surface texture: 10 smooth
Stipe width: 6
Stipe length: 70
Gill attachment: 1 adnate
Gill collarium: No
Gill sawtooth edge: No
Gills break from cap: No
Gills deliquescent: No
Gills mottled face: No
Gills secede from stalk: No
Gills waxy feel: Yes
Gills anastomosing: No
Gills forked: No
Ring type: 5 none
Partial veil type: 5 none
Ring location on stalk: 5 none
Ring number: 3 none
Ring color: 17 none - no stains or not applicable
Volva type: 6 none
Volva color: 17 none - no stains or not applicable
Latex color: 7 red
Latex stain color: 7 red
Reaction ammonia color: 17 none - no stains or not applicable
Reaction Fe. Sul. color: 17 none - no stains or not applicable
Reaction Melzer's color: 13 blue
Reaction potassium: 17 none - no stains or not applicable
Spore shape: 3 elliptical
cystidia: long, pointed cheilocystidia
