North Vancouver, Capilano River Regional Park, just off Second Canyon Viewpoint trail
Latitude
49.354512
Longitude
-123.112839
Altitude
96 m
Date
01/01/2021 (DD/MM/YYYY)
GeneBank Accession Number
Morphological Description
Macroscopic characters: trumpet-shaped (infundibuliform) individual mushrooms with a slightly clavate stipe; light grey-brown cap with slightly upturned and undulating margins; creamy white gills and white spore print; stipe is similar in color to cap, although with a coating of fibrils; no color change with bruising or time; earthy and mild taste and odour; cap 2.5-3.5 centimeters across; stipe 0.5-1 centimeter in thickness; total height 7.5-9 centimeters
Microscopic characters: ellipsoid (oval), smooth, white to hyaline spores from 5-8 micrometers in length and 3-4 micrometers in width; gills lined with basidia; cystidia not present
Collector
Edward Sun
Number
E.SUN2021
Other Collectors
Andrea McMinigal, Lucie Radnidge
Determined by
Edward Sun
Host Substratum
On hemlock leaf litter (Tsuga sp.), moss (Kindbergia sp.), and humus
Notes
Individual infundibuliform mushrooms growing in leaf litter between the roots of a sword fern (Polystichum sp.) and near hemlocks (Tsuga sp.); slightly bulbous base with white basal mycelia; bright white gills; upper surface of cap is colored grey; stipe is slightly fibrous in texture
Habitat
mixed forest, growing terrestrially at the base of a sword fern (Polystichum sp.); also associated with hemlock (Tsuga sp.)
DNA sequence in GeneBank
>Nucleotide_alignment_(modified)_consensus_sequence Alignment of 2 sequences: EdwardSun-ITS1F.ab1, EdwardSun-ITS4.ab1 (reversed) CATTATCTAATCTGTGASGTGGTTGTGCTGGCCCTGGCTTGTCCAAGGCATGTGCACGCCGCTCTACATTTTTACCACCTGTGCACCTTTTGTAGACTCGGATATCTCTCAAACATGCTGTAGGTAAGAGGCTTGCAGTGGCTCTTTTTTGTCCTGCTTTCCTTACATGTCCTGAAATATGGTCACCCTTCTACGCATGTCAGGCTGCTTGGGTTCAAAGTCATTCAAAGAACGCACTCTCCCACTCTCGTGGGCGGATGTAAATGGCTTTGAGCATGGGGATCTGCAACTTGTTGCTTTCCCTGCTTTTCCGACTCTCACCAGTTGGTCACCTTTTCAACAGCTTGCTTTTGGTCTGGGGGTTGGGACCTCTTTCTTTTTGAAGGAGGTTGGCTGCCCCTGCTTTCCAGTCTATGTTTTACACACCCCTTTTGTATGTCACAGAATGTCATCAATGGCTTTGCCTAGCATAGCTATAAATTTATACAACTTTCAACAATGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAACGCGATATGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGTGTCATTAAATTATCAACCTTTTCTTTTGTAACGATCGATCAGGCTTGGATGTGGGGGCTGCCGGTCTCTCAGAGATCGGCTCCCCTTAAATGCATTAGTGGAACCCTTTGTGGATCATTATTGGCGTGATAATTATCTATCCCAGTGATCGTGAAGCAAGCCTAACAAGCACCAGGGTTTGGCTTATAACCGTCCCTCTCTGGGACAAATCTTCATTTTAATG
Name of Sequencer
Edward Sun
Specimen Images
Cap shape when mature
2 funnel
phylum
Basidiomycota
material collected
gilled mushroom
morphology summary
Material collected: gilled mushroom
Habit: 2 numerous or trooping, but not in clumps
Color of top surface: 9 brown- use when other browns do not fit
Secondary color top surface: 9 brown- use when other browns do not fit
Spore print color: 1 white
Hymenium color when young: 1 white
Hymenium color when mature: 1 white
Spore length: 7.8
Spore width: 5.5
Smell: 2 mild/none
Taste: 3 mild/none
Flesh hardness: 2 firm, fleshy
Cap shape when mature: 2 funnel
Cap shape in center: 3 depressed
Cap shape from above: 1 circular-even if wavy
Cap color with age: 9 brown- use when other browns do not fit
Cap stain color: 17 none - no stains or not applicable
Cap width: 35
Cap surface texture: 2 smooth
Cap stickiness: 5 moist feel
Cap has concentric zones of color: Yes
Cap stalk easily part: No
Cap hygrophanous: No
Cap flesh color: 2 light gray
Cap flesh stain color: 17 none - no stains or not applicable
Flesh toughness: 2 easy to break or tear, but not fragile
Flesh fracture: 3 fibrous-tears easier in one direction
Cap cross section: 1 upturned
Cap margin surface: 2 smooth
Cap edge: 1 smooth
Stipe shape: 2 clavate
Stipe core: 3 pithy
Stipe position: 1 central
Stipe flesh hardness: 2 firm, fleshy
Stipe flesh toughness: 2 easy to break or tear, but not fragile
Stipe flesh fracture: 3 fibrous-tears easier in one direction
Stipe flesh color: 2 light gray
Stipe flesh stain color: 17 none - no stains or not applicable
Stipe primary color: 8 tan - light brown
Stipe secondary color: 2 light gray
Stipe stain color: 17 none - no stains or not applicable
Stipe surface texture: 8 fibrilose
Stipe width: 7
Stipe length: 42
Gill attachment: 3 decurrent
Gill collarium: No
Gill sawtooth edge: No
Hymenium stain color: 17 none - no stains or not applicable
Gills break from cap: No
Gills deliquescent: No
Gills mottled face: No
Gills secede from stalk: No
Gills waxy feel: No
Gills anastomosing: No
Gills forked: Yes
Ring type: 5 none
Partial veil type: 5 none
Ring location on stalk: 5 none
Ring number: 3 none
Ring color: 17 none - no stains or not applicable
Volva type: 6 none
Volva color: 17 none - no stains or not applicable
Latex color: 17 none - no stains or not applicable
Latex stain color: 17 none - no stains or not applicable
Reaction ammonia color: 17 none - no stains or not applicable
Reaction Fe. Sul. color: 17 none - no stains or not applicable
Reaction Melzer's color: 17 none - no stains or not applicable
Reaction potassium: 17 none - no stains or not applicable
Spore shape: 3 elliptical
Spore ornamentation: none
cystidia: absent
clamp connections: present
cap cuticle type: smooth (glabrous); soft; most; light grey-brown
trama type: fibrous, white
