Browse Record

Family Russulaceae
Accession Number
Genus Lactarius
Species subviscidus
Species Author Hesler  &  A.H.  Sm.
Country Canada
Province_State British  Columbia
Location Capilano  River  regional  park,  near  hatchery 
Latitude 49.354
Longitude -123.117
Altitude 100  m
Date 23/10/2021    (DD/MM/YYYY)
GeneBank Accession Number
Morphological Description Cap=  reddish  brown,  middle  darker,  periphery  lighter.  Cap  round,  depressed  in  the  middle.  Gills  light  orange  and  match  stem,  decurrent.  Cap  slippery  when  picked,  dried  with  time  after  picking.  White  creamy  latex  produced  from  gills.  Spores  light  yellow.  When  meltzers  added,  spores  had  amyloid  reaction  with  spines  becoming  blue. 
Collector Lucie  Radnidge
Number LR2021OCT23
Other Collectors Andrea  McMinigal,  Edward  Sun
Determined by Lucie  Radnidge
Host Substratum wett  duff  under  Hemlock
Notes
Habitat Mixed  forest.  Located  in  wet  mossy  duff  under  hemlock
DNA  sequence  in  GeneBank CATTATCGTACAAAATGTGAGGGGGCATGCAAGGGCTGTCGCTGACTTCAAAGTCGTGCACGCCCCGGGTGTGTCCCCTCACATAATAATCCATCTCACCCTTTGTGCATCACCGCGTGGGCGCCCTTTGGGATCATCTCGGAGGGGGCTCGCGTTTTCACACAAACCCCCCCCCCTTTTAAAAGTGTAGAATGACCTCATATATGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAACCTCAACCTCCTTGGTTTCTTCTGGAGACCAAAGCAGGCTTGGACTTTGGAGGCCTTTGCTGGTGCCTCTCTCTTTTGAAGTGCCAGCTCCTCTTAAACAAATTAGCAGGGTCCTCTTTGCTGATCCTCGACGTGTGATAAGATGTTTCCATGTCTTGGTTTCTGGCTCTGTCACCTTTTGGGACCCGCTTCTAACCGTCTGGACCTTGTGTCGAGACAATGTTCGAGCATGATGTCTCCCTTCTCGGGAAGCTCCCTCGACCCCACGAACCCTTGACCTCAAA
Name  of  Sequencer
Specimen Images
Image of 2021_Lucie_1.jpg
Cap  shape  when  mature 3 convex  to  plane
phylum Basidiomycota
material  collected gilled  mushroom
morphology  summary Material  collected:  gilled  mushroom
Habit:  2  numerous  or  trooping,  but  not  in  clumps
Color  of  top  surface:  10  rust  brown  (reddish  brown)
Spore  print  color:  3  pale  yellow  or  cream
Spore  length:  7
Spore  width:  5
Cap  shape  when  mature:  3 convex  to  plane
Cap  shape  in  center:  3  depressed
Cap  shape  from  above:  1  circular-even  if  wavy
Cap  width:  20
Cap  surface  texture:  2  smooth
Cap  stickiness:  3  sticky  or  slimy  when  wet
Stipe  position:  1  central
Stipe  flesh  toughness:  2  easy  to  break  or  tear,  but  not  fragile
Stipe  flesh  color:  5  orange
Stipe  flesh  stain  color:  17  none  -  no  stains  or  not  applicable
Stipe  length:  40
Gill  attachment:  3  decurrent
Latex  color:  1  white
Reaction  Melzer's  color:  13  blue
Time  Modified 07:54:43
Date  Created 02/12/2021
mycology project ID 826