Browse Record

Family Inocybaceae
Accession Number
Genus Inosperma
Species maximum
Species Author (A.H.  Sm.)  Matheny  &  Esteve-Rav. 
Country Canada
Province_State British  Columbia
Location Capilano    River    Regional    Park
4500    Capilano    Park    Road   
North    Vancouver,    BC
V7R    4L3
Latitude 49.3
Longitude -123.1
Altitude 89  m
Date 23/10/2021    (DD/MM/YYYY)
GeneBank Accession Number
Morphological Description
Collector Sewit  Yemane
Number SW2021Oct23
Other Collectors
Determined by Sewit  Yemane
Host Substratum
Notes Only  one  specimen  was  found  and  not  growing  as  a  pair.
Habitat In  a  temperate  rainforest  this  specimen  was  found  under  a  fallen  tree  with  dry  dirt  surrounding  it. 
It  was  found  alone  with  no  other  visible  mushroom/fungi.  It  was  only  1  out  of  1  and  not  growing  as  a  pair  (or  multiples). 
DNA  sequence  in  GeneBank CATTACTGAAGTATCATAATGAGTTGTTGCTGTTATCTCGTGCACGCTCGTTATTCTTCNTTTCCCCATCATTTGTGCATCACTTGTGTGGATCCTTTGTCAGAGTTCATCTCAGACGATTGGGA  CTGCTTTGCAAAGTTTAACTATTTGCGGGGCTTTCCTTGTATCTACATGTATTTTTCACATACACCAAATATCAGAAGGAAAAATAAATTTGAATTGTTATACAACTTTCAGCAACGGATCTCTT  GGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCTTGGTATTCTGAGGAGCATGCCTGTTT  GAGTGTCATTTTAATATCTCAACCACATGCAATGTGGCTTGGACTTGGAGGAATGTGCAGGCTTTGACTTCTCGTAGTCTGCTCCTCTGAAAAATATAAGTGGTACCTATATTGGAACTCTGGCT  AGGTGTGATACATATCTGCATCTAATCGAGGTTACCTATGGTTATGCTGCTGATTATTATGACTTTGATAAAC
Name  of  Sequencer
Specimen Images
Image of 2021_Sewit_1.jpg
Cap  shape  when  mature 1┬áconical/bell  shape
phylum Basidiomycota
material  collected gilled  mushroom
morphology  summary Material  collected:  gilled  mushroom
Cap  shape  when  mature:  1┬áconical/bell  shape
Time  Modified 07:54:43
Date  Created 23/12/2021
mycology project ID 854