Browse Record

Family Tricholomataceae
Accession Number F34337
Genus Melanoleuca
Species verrucipes
Species Author   Rolf  Singer  (Revue  Mycol.,  Paris  4(1):  68  (1939))
Country Canada
Province_State British  Columbia
Location This  specimen  was  collected  from  the  garden  along  the  sidewalk  near  5  Westbrook  Mall,  Vancouver,  BC,  V6T  1J6.  The  specimen  was  found  approximately  6  meters  from  the  edge  of  the  motor  vehicle  road,  next  to  a  building  air  vent. 
Latitude 49.271
Longitude -123.248
Altitude 83m
Date 23/10/2021    (DD/MM/YYYY)
GeneBank Accession Number OR488579
Morphological Description
Collector Steve  Shan
Number SXY22OCT01
Other Collectors
Determined by Steve  Shan
Host Substratum Garden  bedding  composed  of  decomposing  woodchip,  worm  casting,  and  manure
Notes Cap  diameter:  75.5mm
Cap  thickness:  13mm  near  the  stipe,  6mm  near  the  edge  of  the  cap
Cap  shape:  plane,  slightly  concave  with  a  small  bump  at  the  middle,  with  a  sawtooth-like  edge.
Cap  color:  caramel  near  the  center,  mostly  beige
Cap  texture:  scaley,  concentric  circle  groove  9.6mm  away  from  the  edge
Stipe  length:  23.2mm
Stipe  thickness:  9.8mm  near  the  cap,  13.2  near  the  base
Stipe  structure:  short,  flashy,  caramel  and  watery  on  the  inside
Stipe  texture:  base  color  beige/white,  with  dark  caramel/brown  scale
Spore  color:  white
Spore  length:  6-8um
Spore  width:  4-5um

Reversed  ITS4  sequence:  TGCTTAAGTTCAGCGGGTAGTCCTACCTGATTTGAGGTCAAATAATAATGAAAATTGTCCAACTCAATGGACTTTTAGCAGCCAGACAGGGTAGCACTGCAAACAGTCCAAGATGTAGATTGTTATCACATCAGATAGACAGTTGCAACAGGAGTCTTGCTAATGACTTTTAGGAGAGCTGACTTTGTTAAAAACCAGCAAAACCCCCCATATCCAACCCCACCAGCTGAGAATAAACTCAGAAAAGGGATTGAGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGTTGAAAGTTGTATTAAGTTTTTATGGCCTAATCAAAAGAAAGGGCCAGATAATTAACATTCCAAAGACATACTAATGAGGTGTAAATTGATAATAAAAAACATAGGCTGGATGCACAAAGGAGAGTTTTTTTTAGAAAAAAAATCAATCCTTCAATCCAAGAATAGAATAGACTTTAATTTATTTCAATTCTTGAGAGCAAATATCCAAGCCTACAAAGGATGCACAGGTGGAGAAAGAATGAAACAAAGGTGAATGTGCACATGTTCCTAAGAACCAGCAGCAATCCACCAAGTTTATTCATTAATG
Habitat This  specimen  was  found  in  a  newly  built  garden,  with  no  weeds  growing  in  it  and  the  plants  nearby  were  young.  The  garden  seems  to  be  bedded  with  decomposing  wood  chips,  worm  cast,  and  manure.  There's  no  shade  where  the  mushroom  was  found,  the  ground  was  very  moist,  and  there  were  plenty  of  other  species  of  mushroom  growing  near  it.  No  insects  were  visible  on  the  surface  of  the  ground.  The  specimen  was  also  near  a  newly  built  apartment  building,  and  during  construction,  all  dirt  where  the  specimen  was  found  was  removed,  which  suggests  that  this  specimen  was  very  likely  developed  some  time  during  the  last  year.
DNA  sequence  in  GeneBank
Name  of  Sequencer
Specimen Images
Image of 2022_Shan39.jpeg
Cap  shape  when  mature 3 convex  to  plane
phylum Basidiomycota
material  collected gilled  mushroom
morphology  summary Material  collected:  gilled  mushroom
Habit:  1  solitary  or  scattered
Color  of  top  surface:  3  pale  yellow  or  cream
Secondary  color  top  surface:  8  tan  -  light  brown
Spore  print  color:  1  white
Hymenium  color  when  young:  3  pale  yellow  or  cream
Hymenium  color  when  mature:  3  pale  yellow  or  cream
Spore  length:  68
Spore  width:  45
Smell:  3  garlic/onion
Taste:  7  other
Flesh  hardness:  2  firm,  fleshy
Cap  shape  when  mature:  3 convex  to  plane
Cap  shape  in  center:  2  even  or  flat
Cap  shape  from  above:  1  circular-even  if  wavy
Cap  color  with  age:  17  none  -  no  stains  or  not  applicable
Cap  stain  color:  17  none  -  no  stains  or  not  applicable
Cap  width:  75.5
Cap  surface  texture:  1  scales  of  any  kind
Cap  stickiness:  1  dry
Cap  has  concentric  zones  of  color:  Yes
Cap  stalk  easily  part:  No
Cap  hygrophanous:  No
Cap  flesh  color:  3  pale  yellow  or  cream
Cap  flesh  stain  color:  17  none  -  no  stains  or  not  applicable
Flesh  toughness:  2  easy  to  break  or  tear,  but  not  fragile
Flesh  fracture:  2  irregular  tear
Cap  cross  section:  1  upturned
Cap  margin  surface:  1  pleated,  grooved,  streaked,  or  ribbed(edge)
Cap  edge:  3  scalloped
Stipe  shape:  1  bulbous
Stipe  core:  1  solid
Stipe  position:  1  central
Stipe  flesh  hardness:  2  firm,  fleshy
Stipe  flesh  toughness:  2  easy  to  break  or  tear,  but  not  fragile
Stipe  flesh  fracture:  3  fibrous-tears  easier  in  one  direction
Stipe  flesh  color:  9  brown-  use  when  other  browns  do  not  fit
Stipe  flesh  stain  color:  17  none  -  no  stains  or  not  applicable
Stipe  primary  color:  3  pale  yellow  or  cream
Stipe  secondary  color:  9  brown-  use  when  other  browns  do  not  fit
Stipe  stain  color:  17  none  -  no  stains  or  not  applicable
Stipe  surface  texture:  2  scabers  -  raised  dots
Stipe  width:  10
Stipe  length:  23.2
Gill  attachment:  6  notched
Gill  collarium:  No
Gill  sawtooth  edge:  No
Hymenium  stain  color:  3  pale  yellow  or  cream
Gills  break  from  cap:  No
Gills  deliquescent:  No
Gills  mottled  face:  No
Gills  secede  from  stalk:  No
Gills  waxy  feel:  No
Gills  anastomosing:  No
Gills  forked:  No
Ring  type:  5  none
Partial  veil  type:  5  none
Ring  location  on  stalk:  5  none
Ring  number:  3  none
Ring  color:  17  none  -  no  stains  or  not  applicable
Volva  type:  6  none
Volva  color:  17  none  -  no  stains  or  not  applicable
Latex  color:  17  none  -  no  stains  or  not  applicable
Latex  stain  color:  17  none  -  no  stains  or  not  applicable
Reaction  ammonia  color:  17  none  -  no  stains  or  not  applicable
Reaction  Fe.  Sul.  color:  17  none  -  no  stains  or  not  applicable
Reaction  Melzer's  color:  17  none  -  no  stains  or  not  applicable
Reaction  potassium:  17  none  -  no  stains  or  not  applicable
Spore  shape:  3  elliptical
Time  Modified 07:52:51
Date  Created 02/12/2022
mycology project ID 865