Browse Record

Family Hypocreaceae
Accession Number
Genus Hypomyces
Species lactifluorum
Species Author Tul.  &  C.  Tul.  1860
Country Canada
Province_State British  Columbia
Location North  Vancouver,  Capilano  River  Regional  Park,  ~300  m  south  into  Pipeline  trail  from  Pipeline  Bridge,  ~0.5  m  west  of  the  path
Latitude 49.351927
Longitude -123.113393
Altitude ~96  m
Date 08/01/2022    (DD/MM/YYYY)
GeneBank Accession Number
Morphological Description Odor:  lobster/seafood-like;  earthy,  farinaceous,  Taste:  lobster/seafood-like,  agreeable,  farinaceous
Collector Beatrice  Vandenberghe
Number BV2022Oct22.6
Other Collectors
Determined by Beatrice  Vandenberghe
Host Substratum On  living  host  fungus  Russula  aff.  Brevipes
Notes Morphology  primarily  describes  host,  Russula  aff.  Brevipes,  of  which  its  attributes  have  been  distorted  due  to  parasitic  infection
Habitat Growing  on  living  Russula,  otherwise  bare  and  terrestrial,  partially  buried  in  dry  soil
DNA  sequence  in  GeneBank CATTATCGTAAAATGGGGGTACCAGGGCTGTCGCTGACTTTTGTCGTGCACGCCCGAGTGCTCTCACATACAAATATCCATCTCACCCCTTTGTGCATCACCGCGTGCGTCCCCCCTTCCTCGGAGGGGGGTGCTCACGTTTTTAACATCAAACACCTAGTATAGAATGTTCTTTGCGCGATCATGCGCGATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAACATCCTCAACCTGCTTGGTTTTTATCAAAACCAACTAGGCTTGGAATTTGGAGGTTTTCTGCTGGCATCCTCCGAAGCCAGCTCCTCTTAAATGTATCAGTGGGATCCGCTTTGCTAGATCCTTGACGTTGATAAGATGTTTCTACGTCTTGGGTTTCGCTCGGGAAGGACCTGCTTCTAACCGTCCCATCAGGGACAATGTTCGAGCCGATCGCCCTTCACGGGGTGGGAAGCTTTCGACCCATCGAACCTTGACC
Name  of  Sequencer
Specimen Images
Image of 2022_8226.jpeg
Cap  shape  when  mature 2 funnel
phylum Ascomycota
material  collected perithecium
morphology  summary Material  collected:  perithecium
Habit:  2  numerous  or  trooping,  but  not  in  clumps
Color  of  top  surface:  5  orange
Secondary  color  top  surface:  3  pale  yellow  or  cream
Spore  print  color:  17  none  -  no  stains  or  not  applicable
Spore  length:  35
Spore  width:  40
Smell:  6  other
Taste:  7  other
Flesh  hardness:  2  firm,  fleshy
Cap  shape  when  mature:  2 funnel
Cap  shape  in  center:  3  depressed
Cap  shape  from  above:  2  irregular
Cap  color  with  age:  5  orange
Cap  width:  25
Cap  surface  texture:  3  rough,  wrinkled,  cracked,  warts
Cap  stickiness:  1  dry
Cap  hygrophanous:  No
Cap  flesh  color:  3  pale  yellow  or  cream
Flesh  toughness:  2  easy  to  break  or  tear,  but  not  fragile
Stipe  position:  2  off-center
Stipe  flesh  hardness:  2  firm,  fleshy
Stipe  flesh  toughness:  2  easy  to  break  or  tear,  but  not  fragile
Stipe  flesh  color:  3  pale  yellow  or  cream
Stipe  primary  color:  5  orange
Stipe  secondary  color:  3  pale  yellow  or  cream
Stipe  surface  texture:  2  scabers  -  raised  dots
Stipe  width:  8
Stipe  length:  22
Gill  attachment:  3  decurrent
Gills  break  from  cap:  No
Gills  waxy  feel:  No
Time  Modified 07:52:51
Date  Created 08/12/2022
mycology project ID 876