Browse Record

Family Amanitaceae
Accession Number
Genus Amanita
Species augusta
Species Author Bojantchev&Davis
Country Canada
Province_State British  Columbia
Location Capilano  Regional  Park,  Giant  Trail
5077  Capilano  Rd,  North  Vancouver,  BC 
V7R  4K4
Latitude 49.3556770
Longitude -123.1113010
Altitude 86
Date 23/10/2021    (DD/MM/YYYY)
GeneBank Accession Number RID-SGRMU3HK016
Morphological Description
Collector Gurveen  Bajwa
Number GB06
Other Collectors Brianna  Archibald  and  Joanne  Kit
Determined by Gurveen  Bajwa
Host Substratum Dry  soil
Notes Found  solitary
Habitat Situated  near  various  tree  species  and  foliage.
DNA  sequence  in  GeneBank CATTACTGAGCGAAATAGGTGGCAAGGCTGTCGCGGGGTTTAACGAGCATGTGCACGTCTTTTGCTGCTTGCTTCATTCTCTTTTCCACCTGTGCACTCTTTGTAGACACTCGGGATGGGAGAGAGGTTGGCATTGATGGTTGACCTCTCTTGATATTGAAAAGTCTGGGTGTTTATGTATTTTTTGACATACACGGTTGAATGTCTATAGAATGAAATGTAGGCTTTTGTCAGCCTTTAAATGATAAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATATCTCAAAAAGTTTGTGCTTTTTTGGCATAAGATTTTTTGGACATTGGGAGTTGCCGGCTGCTGATAAAAGTGGTGGGCTCTTCTGAAAAGCATTAGTTGAGGAGCTTTGCACTCTATTGGTGTGATAGACTATCTATGCCAGGAGATGCTTCATGATCCTCTGCCATCTAACTGTCTTTATTAGACAACATGATAAACTTGACC
Name  of  Sequencer Gurveen  Bajwa
Specimen Images
Image of 2022_8317.jpeg
Image of 2022_8314.jpeg
Cap  shape  when  mature 3 convex  to  plane
phylum Basidiomycota
material  collected gilled  mushroom
morphology  summary Material  collected:  gilled  mushroom
Habit:  1  solitary  or  scattered
Color  of  top  surface:  9  brown-  use  when  other  browns  do  not  fit
Secondary  color  top  surface:  4  yellow/gold
Spore  print  color:  1  white
Hymenium  color  when  young:  1  white
Hymenium  color  when  mature:  3  pale  yellow  or  cream
Spore  length:  7.875
Spore  width:  5.25
Smell:  2  mild/none
Flesh  hardness:  2  firm,  fleshy
Cap  shape  when  mature:  3 convex  to  plane
Cap  shape  in  center:  3  depressed
Cap  shape  from  above:  1  circular-even  if  wavy
Cap  color  with  age:  9  brown-  use  when  other  browns  do  not  fit
Cap  stain  color:  17  none  -  no  stains  or  not  applicable
Cap  width:  .51
Cap  surface  texture:  1  scales  of  any  kind
Cap  stickiness:  1  dry
Cap  has  concentric  zones  of  color:  Yes
Cap  stalk  easily  part:  Yes
Cap  flesh  color:  3  pale  yellow  or  cream
Flesh  toughness:  2  easy  to  break  or  tear,  but  not  fragile
Flesh  fracture:  3  fibrous-tears  easier  in  one  direction
Cap  margin  surface:  1  pleated,  grooved,  streaked,  or  ribbed(edge)
Cap  edge:  1  smooth
Stipe  shape:  3  equal
Stipe  core:  1  solid
Stipe  position:  1  central
Stipe  flesh  hardness:  2  firm,  fleshy
Stipe  flesh  toughness:  2  easy  to  break  or  tear,  but  not  fragile
Stipe  flesh  fracture:  3  fibrous-tears  easier  in  one  direction
Stipe  flesh  color:  3  pale  yellow  or  cream
Stipe  primary  color:  8  tan  -  light  brown
Stipe  secondary  color:  3  pale  yellow  or  cream
Stipe  surface  texture:  6  tuft-like  scales
Stipe  length:  76.4
Gill  attachment:  5  free
Gill  sawtooth  edge:  No
Hymenium  stain  color:  17  none  -  no  stains  or  not  applicable
Gills  mottled  face:  No
Gills  secede  from  stalk:  Yes
Gills  waxy  feel:  No
Ring  type:  1  skirt-like
Partial  veil  type:  5  none
Ring  location  on  stalk:  1  upper  stalk
Ring  number:  1  single
Ring  color:  4  yellow/gold
Volva  type:  1  sack-like
Volva  color:  1  white
Latex  color:  17  none  -  no  stains  or  not  applicable
Latex  stain  color:  17  none  -  no  stains  or  not  applicable
Reaction  Melzer's  color:  12  greenish
Spore  shape:  3  elliptical
Time  Modified 07:52:51
Date  Created 08/12/2022
mycology project ID 878