Browse Record

Family Paxillaceae
Accession Number
Genus Paxillus 
Species involutus 
Species Author (Batsch)  Fr.
Country Canada
Province_State British  Columbia
Location North  Vancouver,  Capilano  River  Regional  Park,  Giant  Fir  trail 
Latitude 49..3551950
Longitude -123.1110920
Altitude 83
Date 23/10/2021    (DD/MM/YYYY)
GeneBank Accession Number T51XHMS3013 
Morphological Description
Collector B.  Archibald 
Number BA1
Other Collectors J.  Kit,  G.  Bajwa
Determined by B.  Archibald 
Host Substratum On  Decaying  log 
Notes Cap  and  stipe  are  yellow  and  turn  a  red  brown  when  handled  or  moved  around.  The  cap  of  the  smaller  fungi  was  about  4  cm  wide  and  the  larger  mushroom  had  a  cap  of  about  10  cm.  Tje  height  ranged  between  7cm-  11.5  cm  tell.  The  cap  curves  down  ,  and  gills  extend  on  to  stipe  (decurrent).    older  mushroom  had  acurvier  cap  with  a  ring  patternon  top.  the  margin  of  the  cap  was  a  dark  brown  color.  No  latex.  Thje  inside  of  the  stip  is  hollow  and  fiberous.  Center  of  mushroom  cap  comes  to  a  point.  The  texture  of  the  cap  is  smooth  and  spongy. 
Habitat Found  on  decaying  log  surrounded  by  moist  soil,  moss,  woodchip,  and  leaves.  Surrounding  deciduous  and  coniferous  trees  providing  shade.
DNA  sequence  in  GeneBank CATTATCGAAAAGCAATCCGGGGGGGAGGCGACCGAGCGAAGTTTGGTAGATCGTAGGGATTGTCGCTGGCCTTTGGAAACGAAGGCATGTGCACGTTCCGAGTTCTCCTTAGTCCTCCTTTGCCTTTCCTTTGGAAAACCCTTTCTTCACACCCGTGCACCCATTGTAGGTCTCCGCGAGGGGATCTATGTCTTCACATAAACACTACGTATGTCTAGGAATGTATCTAAAAGCGTCGGACGGCTTGGCTTCGTGCCCGGTCGGCGACGGTAAAGAACCATAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTAATTCTCAACCATCCCTCGATTCGTTTCGAGGGTTTGGCTTGGATTCTGGGGGCTGCCGGGCGACCCTAGGGTCTTCGGCTCTCCTTAAAAGCATTAGCGATGGCGGCGCGATCTAACCCCCATGCATGAACGGCCTTCGACGTGATAATG
Name  of  Sequencer B.Archibald
Specimen Images
Image of 2022_8306.jpeg
Cap  shape  when  mature 3 convex  to  plane
phylum Basidiomycota
material  collected gilled  mushroom
morphology  summary Material  collected:  gilled  mushroom
Cap  shape  when  mature:  3 convex  to  plane
Time  Modified 07:52:51
Date  Created 08/12/2022
mycology project ID 879