Family |
Paxillaceae |
Accession Number |
|
Genus |
Paxillus |
Species |
involutus |
Species Author |
(Batsch) Fr. |
Country |
Canada |
Province_State |
British Columbia |
Location |
North Vancouver, Capilano River Regional Park, Giant Fir trail |
Latitude |
49..3551950 |
Longitude |
-123.1110920 |
Altitude |
83 |
Date |
23/10/2021 (DD/MM/YYYY)
|
GeneBank Accession Number |
T51XHMS3013 |
Morphological Description |
|
Collector |
B. Archibald |
Number |
BA1 |
Other Collectors |
J. Kit, G. Bajwa |
Determined by |
B. Archibald |
Host Substratum |
On Decaying log |
Notes |
Cap and stipe are yellow and turn a red brown when handled or moved around. The cap of the smaller fungi was about 4 cm wide and the larger mushroom had a cap of about 10 cm. Tje height ranged between 7cm- 11.5 cm tell. The cap curves down , and gills extend on to stipe (decurrent). older mushroom had acurvier cap with a ring patternon top. the margin of the cap was a dark brown color. No latex. Thje inside of the stip is hollow and fiberous. Center of mushroom cap comes to a point. The texture of the cap is smooth and spongy. |
Habitat |
Found on decaying log surrounded by moist soil, moss, woodchip, and leaves. Surrounding deciduous and coniferous trees providing shade. |
DNA sequence in GeneBank |
CATTATCGAAAAGCAATCCGGGGGGGAGGCGACCGAGCGAAGTTTGGTAGATCGTAGGGATTGTCGCTGGCCTTTGGAAACGAAGGCATGTGCACGTTCCGAGTTCTCCTTAGTCCTCCTTTGCCTTTCCTTTGGAAAACCCTTTCTTCACACCCGTGCACCCATTGTAGGTCTCCGCGAGGGGATCTATGTCTTCACATAAACACTACGTATGTCTAGGAATGTATCTAAAAGCGTCGGACGGCTTGGCTTCGTGCCCGGTCGGCGACGGTAAAGAACCATAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTAATTCTCAACCATCCCTCGATTCGTTTCGAGGGTTTGGCTTGGATTCTGGGGGCTGCCGGGCGACCCTAGGGTCTTCGGCTCTCCTTAAAAGCATTAGCGATGGCGGCGCGATCTAACCCCCATGCATGAACGGCCTTCGACGTGATAATG |
Name of Sequencer |
B.Archibald |
Specimen Images
|
|
Cap shape when mature |
3 convex to plane |
phylum |
Basidiomycota |
material collected |
gilled mushroom |
morphology summary |
Material collected: gilled mushroom
Cap shape when mature: 3 convex to plane |
Time Modified |
07:52:51 |
Date Created |
08/12/2022 |
mycology project ID
|
879 |