Browse Record

Family Edited  by  mycologyclass  on  12  December  2022  12:18  PM  from  162.156.23.96.
  mycologyclass  added  on  10  December  2022  02:56  PM  from  162.156.23.96. 
Accession Number Xylariaceae
Genus
Species Xylaria
Species Author hypoxylon
Country C.  Linnaeus 
Province_State Canada
Location British  Columbia
Latitude North  Vancouver,  Capilano  River  Regional  Park
Longitude 49.21
Altitude anamorphic  stromata  are  1-2mm  wide  and  20-30mm  tall.  white  sporulating  tip,  rest  of  anamorphic  stroma  is  black  with  small  stiff  hairs.  teleomorphic  stroma  is  ~25mm  wide  at  the  middle  and  tapered  towards  the  tip  and  the  base.  teleopmorphic  stroma  is  black  with  wrinkled  and  rough  surface.
Date 12/01/2022    (DD/MM/YYYY)
GeneBank Accession Number
Morphological Description anamorphic  stromata  are  1-2mm  wide  and  20-30mm  tall.  white  sporulating  tip,  rest  of  anamorphic  stroma  is  black  with  small  stiff  hairs.  teleomorphic  stroma  is  ~25mm  wide  at  the  middle  and  tapered  towards  the  tip  and  the  base.  teleopmorphic  stroma  is  black  with  wrinkled  and  rough  surface.
Collector Emily  Trudeau
Number LC22102022
Other Collectors
Determined by Lilli  Chung
Host Substratum decaying  wood
Notes Photos  show  conidia-bearing  anamorphic  stromata.  Fruiting  bodies  were  tough.
Habitat found  on  decaying  wood  among  Rhytidiadelphus  loreus  moss
DNA  sequence  in  GeneBank
Name  of  Sequencer CATTAAAGAGTTAATTACAACTCCCAAACCCATGTGAACTTACCTTCTGTTGCCTCGGCAGGTCGTGTTTACCCTGTGAGGTCCTACCCTGTAGGACCCTACCTGGTAGACACGGGTACGCCTGCCGGTGGCCCATGAAACTCTGTTAATTCTATGTTATTCTGAATCTATAACTAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCCCTGTTGCTTAGTGTTGGGAGCCTACAGCCTTCTGTAGCTCCCCAAAGTTAGTGGCGGAGTCGGTTCACACTCTAGACGTAGTAGATTCTATCTCGTCTGTAGTGAGGCCGGTCCCCTGCCGTAAAACCCCCCTAATTTTTAAAGGTTGACC
Specimen Images
Image of 2022_8394.jpeg
Cap  shape  when  mature
phylum Ascomycota
material  collected other
morphology  summary Material  collected:  other
Time  Modified 07:52:51
Date  Created 10/12/2022
mycology project ID 908