Browse Record

Family Mycenaceae
Accession Number
Genus Mycena
Species abramsii
Species Author (Murrill)  Murrill
Country Canada
Province_State British  Columbia
Location North  Vancouver,  Capilano  River  Regional  Park,  Second  Canyon  Trail,  ~20m  North  of  Cable  Pool  Bridge,  ~10m  West  of  the  trail  path
Latitude 49.355
Longitude -123.111
Altitude 80  m
Date 28/10/2023    (DD/MM/YYYY)
GeneBank Accession Number
Morphological Description
Collector Faye  Coldwell
Number FC2023Oct6
Other Collectors Sean  Chung,  Megan  Wong,  Vanessa  Chow
Determined by Sean  Chung
Host Substratum On  dead  Tsuga  heterophylla  branch
Notes Grey  brown  to  cream  colour.  No  distinctive  smell  or  taste.  No  latex  or  staining  present.
Habitat On  dead  Tsuga  heterophylla  branch
DNA  sequence  in  GeneBank CATTATTGAATACGATTGGTACTGATGCTGGCTCTTAACTGAGCATGTGCTCGTCCATCTATTTATCTTCTCTTGTGCACATTTTGTAGTCTTGAACGTACCTCTCGCAGTAAAATGCGGTTTGGGAGCTTGGGCGCAAGCCCTTCTTCTGCTTCTTCAAGGCTATGTTTTCATATACACTATAAAGTTACAGAATGTCTTTTAACGATTGCGCTTGTCGTAGTCATTAAACCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCCTATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTATCAACCTTGCTCGCTTTTACCGGCTTGAGTTAGGCTTGGATGTGAGGGCTTGCTGGCTTCCTTCAGTGGATGGTCTGCTCCCTTTAAATGCATTAGTGGGATCTCTTGTGGACCGTCACTTGGTGTGATAATTATCTATGCCASCTGACCTTGAAGCAAACCTTATGGGAACCCGCTCATAACCGTCTTCGGACAACTTTTGACATTTTGACC
Name  of  Sequencer
Specimen Images
Image of IMG_4945.jpeg
Cap  shape  when  mature 1┬áconical/bell  shape
phylum Basidiomycota
material  collected gilled  mushroom
morphology  summary Material  collected:  gilled  mushroom
Habit:  1  solitary  or  scattered
Color  of  top  surface:  8  tan  -  light  brown
Secondary  color  top  surface:  3  pale  yellow  or  cream
Spore  print  color:  1  white
Spore  length:  12.5
Spore  width:  5
Smell:  2  mild/none
Taste:  3  mild/none
Cap  shape  when  mature:  1┬áconical/bell  shape
Cap  width:  2330
Cap  surface  texture:  2  smooth
Cap  stickiness:  1  dry
Cap  has  concentric  zones  of  color:  No
Reaction  Melzer's  color:  17  none  -  no  stains  or  not  applicable
Spore  shape:  3  elliptical
Time  Modified 11:53:38
Date  Created 29/10/2023
mycology project ID 929