Browse Record

Family Boletaceae
Accession Number F035903
Genus Xerocomellus
Species zelleri
Species Author (Murrill)  Klofac
Country Canada
Province_State British  Columbia
Location North  Vancouver,  Capilano  River  Regional  Park,  Second  Canyon  Trail,  ~20m  North  of  Cable  Pool  Bridge,  ~10m  West  of  the  trail  path
Latitude 49.3543777
Longitude
Altitude 105  m
Date 08/01/2023    (DD/MM/YYYY)
GeneBank Accession Number PP550927
Morphological Description stem    longitudinally  irregularly  striped/lined  with    red  and  yellow/cream,    purple-brown    cap,    stem  becomes    creamy    white    at    the    bulb,  hyphal    arrangement    random
Collector Faye  Coldwell
Number FC2023Oct22
Other Collectors Sean  Chung,  Megan  Wong,  Vanessa  Chow
Determined by Faye  Coldwell
Host Substratum Soil/wood  chips
Notes
Habitat Growing  beneath  fallen  tree  on  soil/wood  chips,  in  patch  of  largely  hemlock  and  douglas  fir 
DNA  sequence  in  GeneBank
Name  of  Sequencer CATTATCGAATTTCGAGGGGAGGAAGATGGAGGGGGAGACTGTCGCTGGCCTTCGCTGTGCACGTCTTCCATTTCGTCGACCTTTCTCTTACTCTCACACCTGTGCACACATTGTAGGTCCTCGAAAGAGGATCTATGTTTTCATCATCACACACCACTGTATGTCTAGAATGTATTACGATCGTCGACCGATCTTGCGGTCGGGTGGCGGTCAAATAAATAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGTAATTCTCAACCATGTCTTGATTGATTTCGAGGCATGGCTTGGACTTGGGGGCTGCTGGCGGCGAAAGCTGTCGGCTCTCCTGAAATGCATTAGCAATGGACAGCAATGTCTGACGTGCACGGCCTTGACGTGATAATGATCGTCGTCGCTGGAGCGTCGGATGCGCACACAAGTCCTCTTGCTTCGAATCCATCTGACTTGAGACTTGGACTTTTCGAGCAAAGCTTAGCTACTAGTCGGTTGTGAGGCCGGCGAACGCAGGCTTGCTTGGATGTCGGAGTCCCTCGTCTTTCTTGACGACTTGACC
Specimen Images
Image of IMG_4942.jpeg
Image of 3 convex to plane
Image of Basidiomycota
Image of pored mushroom
Cap  shape  when  mature 3 convex  to  plane
phylum Basidiomycota
material  collected pored  mushroom
morphology  summary Material  collected:  pored  mushroom
Habit:  1  solitary  or  scattered
Color  of  top  surface:  11  dark  brown
Secondary  color  top  surface:  14  purple,  violet,  or  lilac
Spore  print  color:  8  tan  -  light  brown
Hymenium  color  when  young:  3  pale  yellow  or  cream
Hymenium  color  when  mature:  3  pale  yellow  or  cream
Spore  length:  14.5
Spore  width:  3
Smell:  2  mild/none
Taste:  7  other
Flesh  hardness:  2  firm,  fleshy
Cap  shape  when  mature:  3 convex  to  plane
Cap  shape  in  center:  2  even  or  flat
Cap  shape  from  above:  1  circular-even  if  wavy
Cap  color  with  age:  11  dark  brown
Cap  stain  color:  17  none  -  no  stains  or  not  applicable
Cap  width:  44
Cap  surface  texture:  4  hairy,  include  velvety
Cap  stickiness:  5  moist  feel
Cap  has  concentric  zones  of  color:  No
Cap  stalk  easily  part:  No
Cap  hygrophanous:  No
Cap  flesh  color:  10  rust  brown  (reddish  brown)
Cap  flesh  stain  color:  17  none  -  no  stains  or  not  applicable
Flesh  toughness:  2  easy  to  break  or  tear,  but  not  fragile
Flesh  fracture:  2  irregular  tear
Cap  cross  section:  2  recurved
Cap  margin  surface:  2  smooth
Cap  edge:  1  smooth
Stipe  shape:  3  equal
Stipe  core:  1  solid
Stipe  position:  1  central
Stipe  flesh  hardness:  2  firm,  fleshy
Stipe  flesh  toughness:  3  tough  -  does  not  tear  easily
Stipe  flesh  fracture:  2  irregular  tear
Stipe  flesh  color:  3  pale  yellow  or  cream
Stipe  flesh  stain  color:  17  none  -  no  stains  or  not  applicable
Stipe  primary  color:  7  red
Stipe  secondary  color:  3  pale  yellow  or  cream
Stipe  stain  color:  17  none  -  no  stains  or  not  applicable
Stipe  surface  texture:  8  fibrilose
Stipe  width:  48
Stipe  length:  9
Gill  attachment:  1  adnate
Hymenium  stain  color:  17  none  -  no  stains  or  not  applicable
Volva  type:  1  sack-like
Volva  color:  1  white
Latex  color:  17  none  -  no  stains  or  not  applicable
Latex  stain  color:  17  none  -  no  stains  or  not  applicable
Spore  shape:  3  elliptical
Time  Modified 20:50:49
Date  Created 31/10/2023
mycology project ID 934