| Family
|
Exidiaceae |
| Accession Number
|
F33228 |
| Genus
|
Pseudohydnum |
| Species
|
gelatinosum |
| Species Author
|
(Scop.) P. Karst. |
| Date
|
28/10/2017 |
| Morphological Description
|
Spore print: white
Underside: no gills, has teeth of variable sizes housing basidia |
| Collector
|
Anita Poon |
| Number
|
AP20172 |
|
Cap shape when mature |
3 convex to plane |
|
Cap shape in center |
2 even or flat |
|
Cap shape from above |
3 fan or tongue shape |
|
color of top surface |
9 brown- use when other browns do not fit |
|
Secondary color top surface |
1 white |
|
Cap color with age |
9 brown- use when other browns do not fit |
|
Cap stain color |
17 none - no stains or not applicable |
|
Cap width |
36 |
|
Cap surface texture |
2 smooth |
|
Cap stickiness |
5 moist feel |
|
Cap has concentric zones of color |
No |
|
Cap stalk easily part |
No |
|
Cap hygrophanous |
|
|
Cap flesh color |
1 white |
|
Cap flesh stain color |
17 none - no stains or not applicable |
|
Flesh hardness |
1 soft-spongy, including gelatinous |
|
Flesh toughness |
2 easy to break or tear, but not fragile |
|
Flesh fracture |
1 jelly-like |
|
Cap cross section |
5 straight |
|
Cap margin surface |
|
|
Cap edge |
|
|
Stipe shape |
6 taper down |
|
Stipe core |
1 solid |
|
Stipe position |
1 central |
|
Stipe flesh hardness |
1 soft-spongy, including gelatinous |
|
Stipe flesh toughness |
2 easy to break or tear, but not fragile |
|
Stipe flesh fracture |
1 jelly-like |
|
Stipe flesh color |
1 white |
|
Stipe flesh stain color |
17 none - no stains or not applicable |
|
Stipe primary color |
1 white |
|
Stipe secondary color |
17 none - no stains or not applicable |
|
Stipe stain color |
17 none - no stains or not applicable |
|
Stipe surface texture |
10 smooth |
|
Stipe width |
15 |
|
Stipe length |
15 |
|
Gill attachment |
|
|
Gill collarium |
|
|
Gill sawtooth edge |
|
|
Hymenium color when young |
1 white |
|
Hymenium color when mature |
1 white |
|
Hymenium stain color |
17 none - no stains or not applicable |
|
Gills break from cap |
|
|
Gills deliquescent |
|
|
Gills mottled face |
|
|
Gills secede from stalk |
|
|
Gills waxy feel |
|
|
Gills anastomosing |
|
|
Gills forked |
|
|
Ring type |
5 none |
|
Partial veil type |
5 none |
|
Ring location on stalk |
5 none |
|
Ring number |
3 none |
|
Ring color |
17 none - no stains or not applicable |
|
Volva type |
6 none |
|
Volva color |
17 none - no stains or not applicable |
|
Habit |
|
|
Taste |
3 mild/none |
|
Smell |
2 mild/none |
|
Spore print color |
1 white |
|
Latex color |
17 none - no stains or not applicable |
|
Latex stain color |
17 none - no stains or not applicable |
|
Reaction ammonia color |
|
|
Reaction ferrous sulphate color |
|
| Reaction Melzer's color
|
|
|
Reaction potassium |
|
|
Spore shape |
6 circular |
|
Spore ornamentation |
smooth |
|
Spore length |
6 |
|
Spore width |
5.4 |
|
phylum |
Basidiomycota |
|
material collected |
jelly fungus |
|
trama type |
|
|
cap cuticle type |
|
|
clamp connections |
|
|
cystidia |
|
|
morphology summary |
|
| Notes
|
Small cluster of 6-10 bodies of various sizes; saprotrophic
DNA sequence:
CGTAGGTGACCCTGCGGAGGGATCATTAATGAATTCTCTTTGGCTGATGCGCCTCTGGGCTGCACGTCAAATAATTTCATCCACACACCCCTTGTGCACCTTTGGGACTTGGTAGCCCCTCGTGGGTCGCCTGTCCTCATTTTTTTCCACACCCTCCACAAAGTAACAGCATGTGCGAATTTATAAACAATGAAACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGCGTCACGTGAACATCTCGTCCATGTCATTGTAAAGTGGCATGGATGGGGATTTGGACTGTGCCGTCTCCCGGCTCGTCCTGAAATGCATTAGCTCGGTTTAAGCGACCGTCTCGGTGTGATTAAACATCTACGCCTTGGCCAAGTTGAACGGGCTCACAGCAACCCACATTTTTTACGCTCTGGCCTCAAATCAGGCAG |
|
Date Created |
|
|
Date Modified |
|