| Family
|
Tricholomataceae |
| Accession Number
|
|
| Genus
|
Melanoleuca |
| Species
|
verrucipes |
| Species Author
|
Rolf Singer (Revue Mycol., Paris 4(1): 68 (1939)) |
| Date
|
23/10/2021 |
| Morphological Description
|
|
| Collector
|
Steve Shan |
| Number
|
SXY22OCT01 |
|
Cap shape when mature |
3 convex to plane |
|
Cap shape in center |
2 even or flat |
|
Cap shape from above |
1 circular-even if wavy |
|
color of top surface |
3 pale yellow or cream |
|
Secondary color top surface |
8 tan - light brown |
|
Cap color with age |
17 none - no stains or not applicable |
|
Cap stain color |
17 none - no stains or not applicable |
|
Cap width |
75.5 |
|
Cap surface texture |
1 scales of any kind |
|
Cap stickiness |
1 dry |
|
Cap has concentric zones of color |
Yes |
|
Cap stalk easily part |
No |
|
Cap hygrophanous |
No |
|
Cap flesh color |
3 pale yellow or cream |
|
Cap flesh stain color |
17 none - no stains or not applicable |
|
Flesh hardness |
2 firm, fleshy |
|
Flesh toughness |
2 easy to break or tear, but not fragile |
|
Flesh fracture |
2 irregular tear |
|
Cap cross section |
1 upturned |
|
Cap margin surface |
1 pleated, grooved, streaked, or ribbed(edge) |
|
Cap edge |
3 scalloped |
|
Stipe shape |
1 bulbous |
|
Stipe core |
1 solid |
|
Stipe position |
1 central |
|
Stipe flesh hardness |
2 firm, fleshy |
|
Stipe flesh toughness |
2 easy to break or tear, but not fragile |
|
Stipe flesh fracture |
3 fibrous-tears easier in one direction |
|
Stipe flesh color |
9 brown- use when other browns do not fit |
|
Stipe flesh stain color |
17 none - no stains or not applicable |
|
Stipe primary color |
3 pale yellow or cream |
|
Stipe secondary color |
9 brown- use when other browns do not fit |
|
Stipe stain color |
17 none - no stains or not applicable |
|
Stipe surface texture |
2 scabers - raised dots |
|
Stipe width |
10 |
|
Stipe length |
23.2 |
|
Gill attachment |
6 notched |
|
Gill collarium |
No |
|
Gill sawtooth edge |
No |
|
Hymenium color when young |
3 pale yellow or cream |
|
Hymenium color when mature |
3 pale yellow or cream |
|
Hymenium stain color |
3 pale yellow or cream |
|
Gills break from cap |
No |
|
Gills deliquescent |
No |
|
Gills mottled face |
No |
|
Gills secede from stalk |
No |
|
Gills waxy feel |
No |
|
Gills anastomosing |
No |
|
Gills forked |
No |
|
Ring type |
5 none |
|
Partial veil type |
5 none |
|
Ring location on stalk |
5 none |
|
Ring number |
3 none |
|
Ring color |
17 none - no stains or not applicable |
|
Volva type |
6 none |
|
Volva color |
17 none - no stains or not applicable |
|
Habit |
1 solitary or scattered |
|
Taste |
7 other |
|
Smell |
3 garlic/onion |
|
Spore print color |
1 white |
|
Latex color |
17 none - no stains or not applicable |
|
Latex stain color |
17 none - no stains or not applicable |
|
Reaction ammonia color |
17 none - no stains or not applicable |
|
Reaction ferrous sulphate color |
17 none - no stains or not applicable |
| Reaction Melzer's color
|
17 none - no stains or not applicable |
|
Reaction potassium |
17 none - no stains or not applicable |
|
Spore shape |
3 elliptical |
|
Spore ornamentation |
|
|
Spore length |
6-8 |
|
Spore width |
4-5 |
|
phylum |
Basidiomycota |
|
material collected |
gilled mushroom |
|
trama type |
|
|
cap cuticle type |
|
|
clamp connections |
|
|
cystidia |
|
|
morphology summary |
|
| Notes
|
Cap diameter: 75.5mm
Cap thickness: 13mm near the stipe, 6mm near the edge of the cap
Cap shape: plane, slightly concave with a small bump at the middle, with a sawtooth-like edge.
Cap color: caramel near the center, mostly beige
Cap texture: scaley, concentric circle groove 9.6mm away from the edge
Stipe length: 23.2mm
Stipe thickness: 9.8mm near the cap, 13.2 near the base
Stipe structure: short, flashy, caramel and watery on the inside
Stipe texture: base color beige/white, with dark caramel/brown scale
Spore color: white
Spore length: 6-8um
Spore width: 4-5um
Reversed ITS4 sequence: TGCTTAAGTTCAGCGGGTAGTCCTACCTGATTTGAGGTCAAATAATAATGAAAATTGTCCAACTCAATGGACTTTTAGCAGCCAGACAGGGTAGCACTGCAAACAGTCCAAGATGTAGATTGTTATCACATCAGATAGACAGTTGCAACAGGAGTCTTGCTAATGACTTTTAGGAGAGCTGACTTTGTTAAAAACCAGCAAAACCCCCCATATCCAACCCCACCAGCTGAGAATAAACTCAGAAAAGGGATTGAGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGTTGAAAGTTGTATTAAGTTTTTATGGCCTAATCAAAAGAAAGGGCCAGATAATTAACATTCCAAAGACATACTAATGAGGTGTAAATTGATAATAAAAAACATAGGCTGGATGCACAAAGGAGAGTTTTTTTTAGAAAAAAAATCAATCCTTCAATCCAAGAATAGAATAGACTTTAATTTATTTCAATTCTTGAGAGCAAATATCCAAGCCTACAAAGGATGCACAGGTGGAGAAAGAATGAAACAAAGGTGAATGTGCACATGTTCCTAAGAACCAGCAGCAATCCACCAAGTTTATTCATTAATG |
|
Date Created |
|
|
Date Modified |
|